ID: 988577973

View in Genome Browser
Species Human (GRCh38)
Location 5:32444745-32444767
Sequence CTGCGCAGTGCGGTCGGAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988577973_988577979 1 Left 988577973 5:32444745-32444767 CCGCCTCCGACCGCACTGCGCAG 0: 1
1: 0
2: 0
3: 9
4: 83
Right 988577979 5:32444769-32444791 CGCGCCTGTGCTCGGCATCCTGG 0: 1
1: 0
2: 0
3: 2
4: 111
988577973_988577983 28 Left 988577973 5:32444745-32444767 CCGCCTCCGACCGCACTGCGCAG 0: 1
1: 0
2: 0
3: 9
4: 83
Right 988577983 5:32444796-32444818 TGTAGTCCCCGCCGTCTTCGCGG 0: 1
1: 0
2: 0
3: 0
4: 63
988577973_988577978 -7 Left 988577973 5:32444745-32444767 CCGCCTCCGACCGCACTGCGCAG 0: 1
1: 0
2: 0
3: 9
4: 83
Right 988577978 5:32444761-32444783 TGCGCAGGCGCGCCTGTGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 98
988577973_988577980 2 Left 988577973 5:32444745-32444767 CCGCCTCCGACCGCACTGCGCAG 0: 1
1: 0
2: 0
3: 9
4: 83
Right 988577980 5:32444770-32444792 GCGCCTGTGCTCGGCATCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988577973 Original CRISPR CTGCGCAGTGCGGTCGGAGG CGG (reversed) Exonic