ID: 988577974

View in Genome Browser
Species Human (GRCh38)
Location 5:32444746-32444768
Sequence CGCCTCCGACCGCACTGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988577964_988577974 17 Left 988577964 5:32444706-32444728 CCTCCTCTGCCCCGCTCCTCCTC 0: 1
1: 1
2: 10
3: 271
4: 2141
Right 988577974 5:32444746-32444768 CGCCTCCGACCGCACTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 64
988577970_988577974 1 Left 988577970 5:32444722-32444744 CCTCCTCAGCGGAGAACAGACCG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 988577974 5:32444746-32444768 CGCCTCCGACCGCACTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 64
988577965_988577974 14 Left 988577965 5:32444709-32444731 CCTCTGCCCCGCTCCTCCTCAGC 0: 1
1: 0
2: 4
3: 115
4: 908
Right 988577974 5:32444746-32444768 CGCCTCCGACCGCACTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 64
988577961_988577974 27 Left 988577961 5:32444696-32444718 CCGCTGCCTCCCTCCTCTGCCCC 0: 1
1: 5
2: 38
3: 409
4: 2687
Right 988577974 5:32444746-32444768 CGCCTCCGACCGCACTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 64
988577963_988577974 18 Left 988577963 5:32444705-32444727 CCCTCCTCTGCCCCGCTCCTCCT 0: 1
1: 0
2: 11
3: 164
4: 1601
Right 988577974 5:32444746-32444768 CGCCTCCGACCGCACTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 64
988577971_988577974 -2 Left 988577971 5:32444725-32444747 CCTCAGCGGAGAACAGACCGCCG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 988577974 5:32444746-32444768 CGCCTCCGACCGCACTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 64
988577962_988577974 21 Left 988577962 5:32444702-32444724 CCTCCCTCCTCTGCCCCGCTCCT 0: 1
1: 0
2: 30
3: 194
4: 1720
Right 988577974 5:32444746-32444768 CGCCTCCGACCGCACTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 64
988577960_988577974 28 Left 988577960 5:32444695-32444717 CCCGCTGCCTCCCTCCTCTGCCC 0: 1
1: 2
2: 14
3: 202
4: 1702
Right 988577974 5:32444746-32444768 CGCCTCCGACCGCACTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 64
988577969_988577974 6 Left 988577969 5:32444717-32444739 CCGCTCCTCCTCAGCGGAGAACA 0: 1
1: 0
2: 2
3: 22
4: 370
Right 988577974 5:32444746-32444768 CGCCTCCGACCGCACTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 64
988577968_988577974 7 Left 988577968 5:32444716-32444738 CCCGCTCCTCCTCAGCGGAGAAC 0: 1
1: 0
2: 2
3: 22
4: 176
Right 988577974 5:32444746-32444768 CGCCTCCGACCGCACTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 64
988577967_988577974 8 Left 988577967 5:32444715-32444737 CCCCGCTCCTCCTCAGCGGAGAA 0: 1
1: 0
2: 0
3: 11
4: 127
Right 988577974 5:32444746-32444768 CGCCTCCGACCGCACTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988577974 Original CRISPR CGCCTCCGACCGCACTGCGC AGG Exonic