ID: 988577975

View in Genome Browser
Species Human (GRCh38)
Location 5:32444748-32444770
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988577975_988577980 -1 Left 988577975 5:32444748-32444770 CCTCCGACCGCACTGCGCAGGCG 0: 1
1: 1
2: 1
3: 6
4: 67
Right 988577980 5:32444770-32444792 GCGCCTGTGCTCGGCATCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 183
988577975_988577978 -10 Left 988577975 5:32444748-32444770 CCTCCGACCGCACTGCGCAGGCG 0: 1
1: 1
2: 1
3: 6
4: 67
Right 988577978 5:32444761-32444783 TGCGCAGGCGCGCCTGTGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 98
988577975_988577979 -2 Left 988577975 5:32444748-32444770 CCTCCGACCGCACTGCGCAGGCG 0: 1
1: 1
2: 1
3: 6
4: 67
Right 988577979 5:32444769-32444791 CGCGCCTGTGCTCGGCATCCTGG 0: 1
1: 0
2: 0
3: 2
4: 111
988577975_988577983 25 Left 988577975 5:32444748-32444770 CCTCCGACCGCACTGCGCAGGCG 0: 1
1: 1
2: 1
3: 6
4: 67
Right 988577983 5:32444796-32444818 TGTAGTCCCCGCCGTCTTCGCGG 0: 1
1: 0
2: 0
3: 0
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988577975 Original CRISPR CGCCTGCGCAGTGCGGTCGG AGG (reversed) Exonic