ID: 988577976

View in Genome Browser
Species Human (GRCh38)
Location 5:32444751-32444773
Sequence GCGCGCCTGCGCAGTGCGGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988577976_988577983 22 Left 988577976 5:32444751-32444773 CCGACCGCACTGCGCAGGCGCGC 0: 1
1: 0
2: 0
3: 5
4: 52
Right 988577983 5:32444796-32444818 TGTAGTCCCCGCCGTCTTCGCGG 0: 1
1: 0
2: 0
3: 0
4: 63
988577976_988577979 -5 Left 988577976 5:32444751-32444773 CCGACCGCACTGCGCAGGCGCGC 0: 1
1: 0
2: 0
3: 5
4: 52
Right 988577979 5:32444769-32444791 CGCGCCTGTGCTCGGCATCCTGG 0: 1
1: 0
2: 0
3: 2
4: 111
988577976_988577980 -4 Left 988577976 5:32444751-32444773 CCGACCGCACTGCGCAGGCGCGC 0: 1
1: 0
2: 0
3: 5
4: 52
Right 988577980 5:32444770-32444792 GCGCCTGTGCTCGGCATCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988577976 Original CRISPR GCGCGCCTGCGCAGTGCGGT CGG (reversed) Exonic