ID: 988577977

View in Genome Browser
Species Human (GRCh38)
Location 5:32444755-32444777
Sequence ACAGGCGCGCCTGCGCAGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 62}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988577977_988577987 27 Left 988577977 5:32444755-32444777 CCGCACTGCGCAGGCGCGCCTGT 0: 1
1: 0
2: 1
3: 7
4: 62
Right 988577987 5:32444805-32444827 CGCCGTCTTCGCGGCTCCCCCGG 0: 1
1: 0
2: 1
3: 10
4: 74
988577977_988577979 -9 Left 988577977 5:32444755-32444777 CCGCACTGCGCAGGCGCGCCTGT 0: 1
1: 0
2: 1
3: 7
4: 62
Right 988577979 5:32444769-32444791 CGCGCCTGTGCTCGGCATCCTGG 0: 1
1: 0
2: 0
3: 2
4: 111
988577977_988577980 -8 Left 988577977 5:32444755-32444777 CCGCACTGCGCAGGCGCGCCTGT 0: 1
1: 0
2: 1
3: 7
4: 62
Right 988577980 5:32444770-32444792 GCGCCTGTGCTCGGCATCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 183
988577977_988577988 28 Left 988577977 5:32444755-32444777 CCGCACTGCGCAGGCGCGCCTGT 0: 1
1: 0
2: 1
3: 7
4: 62
Right 988577988 5:32444806-32444828 GCCGTCTTCGCGGCTCCCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 121
988577977_988577983 18 Left 988577977 5:32444755-32444777 CCGCACTGCGCAGGCGCGCCTGT 0: 1
1: 0
2: 1
3: 7
4: 62
Right 988577983 5:32444796-32444818 TGTAGTCCCCGCCGTCTTCGCGG 0: 1
1: 0
2: 0
3: 0
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988577977 Original CRISPR ACAGGCGCGCCTGCGCAGTG CGG (reversed) Exonic