ID: 988577978

View in Genome Browser
Species Human (GRCh38)
Location 5:32444761-32444783
Sequence TGCGCAGGCGCGCCTGTGCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988577971_988577978 13 Left 988577971 5:32444725-32444747 CCTCAGCGGAGAACAGACCGCCG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 988577978 5:32444761-32444783 TGCGCAGGCGCGCCTGTGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 98
988577970_988577978 16 Left 988577970 5:32444722-32444744 CCTCCTCAGCGGAGAACAGACCG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 988577978 5:32444761-32444783 TGCGCAGGCGCGCCTGTGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 98
988577969_988577978 21 Left 988577969 5:32444717-32444739 CCGCTCCTCCTCAGCGGAGAACA 0: 1
1: 0
2: 2
3: 22
4: 370
Right 988577978 5:32444761-32444783 TGCGCAGGCGCGCCTGTGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 98
988577975_988577978 -10 Left 988577975 5:32444748-32444770 CCTCCGACCGCACTGCGCAGGCG 0: 1
1: 1
2: 1
3: 6
4: 67
Right 988577978 5:32444761-32444783 TGCGCAGGCGCGCCTGTGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 98
988577967_988577978 23 Left 988577967 5:32444715-32444737 CCCCGCTCCTCCTCAGCGGAGAA 0: 1
1: 0
2: 0
3: 11
4: 127
Right 988577978 5:32444761-32444783 TGCGCAGGCGCGCCTGTGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 98
988577972_988577978 -4 Left 988577972 5:32444742-32444764 CCGCCGCCTCCGACCGCACTGCG 0: 1
1: 0
2: 0
3: 17
4: 232
Right 988577978 5:32444761-32444783 TGCGCAGGCGCGCCTGTGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 98
988577968_988577978 22 Left 988577968 5:32444716-32444738 CCCGCTCCTCCTCAGCGGAGAAC 0: 1
1: 0
2: 2
3: 22
4: 176
Right 988577978 5:32444761-32444783 TGCGCAGGCGCGCCTGTGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 98
988577965_988577978 29 Left 988577965 5:32444709-32444731 CCTCTGCCCCGCTCCTCCTCAGC 0: 1
1: 0
2: 4
3: 115
4: 908
Right 988577978 5:32444761-32444783 TGCGCAGGCGCGCCTGTGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 98
988577973_988577978 -7 Left 988577973 5:32444745-32444767 CCGCCTCCGACCGCACTGCGCAG 0: 1
1: 0
2: 0
3: 9
4: 83
Right 988577978 5:32444761-32444783 TGCGCAGGCGCGCCTGTGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988577978 Original CRISPR TGCGCAGGCGCGCCTGTGCT CGG Exonic