ID: 988577980

View in Genome Browser
Species Human (GRCh38)
Location 5:32444770-32444792
Sequence GCGCCTGTGCTCGGCATCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 183}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988577975_988577980 -1 Left 988577975 5:32444748-32444770 CCTCCGACCGCACTGCGCAGGCG 0: 1
1: 1
2: 1
3: 6
4: 67
Right 988577980 5:32444770-32444792 GCGCCTGTGCTCGGCATCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 183
988577977_988577980 -8 Left 988577977 5:32444755-32444777 CCGCACTGCGCAGGCGCGCCTGT 0: 1
1: 0
2: 1
3: 7
4: 62
Right 988577980 5:32444770-32444792 GCGCCTGTGCTCGGCATCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 183
988577972_988577980 5 Left 988577972 5:32444742-32444764 CCGCCGCCTCCGACCGCACTGCG 0: 1
1: 0
2: 0
3: 17
4: 232
Right 988577980 5:32444770-32444792 GCGCCTGTGCTCGGCATCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 183
988577971_988577980 22 Left 988577971 5:32444725-32444747 CCTCAGCGGAGAACAGACCGCCG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 988577980 5:32444770-32444792 GCGCCTGTGCTCGGCATCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 183
988577970_988577980 25 Left 988577970 5:32444722-32444744 CCTCCTCAGCGGAGAACAGACCG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 988577980 5:32444770-32444792 GCGCCTGTGCTCGGCATCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 183
988577973_988577980 2 Left 988577973 5:32444745-32444767 CCGCCTCCGACCGCACTGCGCAG 0: 1
1: 0
2: 0
3: 9
4: 83
Right 988577980 5:32444770-32444792 GCGCCTGTGCTCGGCATCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 183
988577969_988577980 30 Left 988577969 5:32444717-32444739 CCGCTCCTCCTCAGCGGAGAACA 0: 1
1: 0
2: 2
3: 22
4: 370
Right 988577980 5:32444770-32444792 GCGCCTGTGCTCGGCATCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 183
988577976_988577980 -4 Left 988577976 5:32444751-32444773 CCGACCGCACTGCGCAGGCGCGC 0: 1
1: 0
2: 0
3: 5
4: 52
Right 988577980 5:32444770-32444792 GCGCCTGTGCTCGGCATCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988577980 Original CRISPR GCGCCTGTGCTCGGCATCCT GGG Intergenic