ID: 988577983

View in Genome Browser
Species Human (GRCh38)
Location 5:32444796-32444818
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988577975_988577983 25 Left 988577975 5:32444748-32444770 CCTCCGACCGCACTGCGCAGGCG 0: 1
1: 1
2: 1
3: 6
4: 67
Right 988577983 5:32444796-32444818 TGTAGTCCCCGCCGTCTTCGCGG 0: 1
1: 0
2: 0
3: 0
4: 63
988577973_988577983 28 Left 988577973 5:32444745-32444767 CCGCCTCCGACCGCACTGCGCAG 0: 1
1: 0
2: 0
3: 9
4: 83
Right 988577983 5:32444796-32444818 TGTAGTCCCCGCCGTCTTCGCGG 0: 1
1: 0
2: 0
3: 0
4: 63
988577977_988577983 18 Left 988577977 5:32444755-32444777 CCGCACTGCGCAGGCGCGCCTGT 0: 1
1: 0
2: 1
3: 7
4: 62
Right 988577983 5:32444796-32444818 TGTAGTCCCCGCCGTCTTCGCGG 0: 1
1: 0
2: 0
3: 0
4: 63
988577981_988577983 0 Left 988577981 5:32444773-32444795 CCTGTGCTCGGCATCCTGGGAGC 0: 1
1: 0
2: 0
3: 16
4: 181
Right 988577983 5:32444796-32444818 TGTAGTCCCCGCCGTCTTCGCGG 0: 1
1: 0
2: 0
3: 0
4: 63
988577976_988577983 22 Left 988577976 5:32444751-32444773 CCGACCGCACTGCGCAGGCGCGC 0: 1
1: 0
2: 0
3: 5
4: 52
Right 988577983 5:32444796-32444818 TGTAGTCCCCGCCGTCTTCGCGG 0: 1
1: 0
2: 0
3: 0
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type