ID: 988577988

View in Genome Browser
Species Human (GRCh38)
Location 5:32444806-32444828
Sequence GCCGTCTTCGCGGCTCCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988577981_988577988 10 Left 988577981 5:32444773-32444795 CCTGTGCTCGGCATCCTGGGAGC 0: 1
1: 0
2: 0
3: 16
4: 181
Right 988577988 5:32444806-32444828 GCCGTCTTCGCGGCTCCCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 121
988577982_988577988 -4 Left 988577982 5:32444787-32444809 CCTGGGAGCTGTAGTCCCCGCCG 0: 1
1: 0
2: 2
3: 11
4: 138
Right 988577988 5:32444806-32444828 GCCGTCTTCGCGGCTCCCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 121
988577977_988577988 28 Left 988577977 5:32444755-32444777 CCGCACTGCGCAGGCGCGCCTGT 0: 1
1: 0
2: 1
3: 7
4: 62
Right 988577988 5:32444806-32444828 GCCGTCTTCGCGGCTCCCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988577988 Original CRISPR GCCGTCTTCGCGGCTCCCCC GGG Intergenic