ID: 988578256

View in Genome Browser
Species Human (GRCh38)
Location 5:32446472-32446494
Sequence CTCTTTCTGAAATGAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988578256_988578257 -6 Left 988578256 5:32446472-32446494 CCTGTTACTCATTTCAGAAAGAG No data
Right 988578257 5:32446489-32446511 AAAGAGAAAATGTAGAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988578256 Original CRISPR CTCTTTCTGAAATGAGTAAC AGG (reversed) Intergenic
No off target data available for this crispr