ID: 988578425

View in Genome Browser
Species Human (GRCh38)
Location 5:32447900-32447922
Sequence CACACCTACAAGTCAAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988578424_988578425 7 Left 988578424 5:32447870-32447892 CCTTCTAATAAGTGAATGCATTG No data
Right 988578425 5:32447900-32447922 CACACCTACAAGTCAAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988578425 Original CRISPR CACACCTACAAGTCAAAAGT AGG Intergenic
No off target data available for this crispr