ID: 988585675

View in Genome Browser
Species Human (GRCh38)
Location 5:32505515-32505537
Sequence CTGCACTATTTGTCTTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988585672_988585675 25 Left 988585672 5:32505467-32505489 CCTGCTCTGTAGCGCTGGGAGCT No data
Right 988585675 5:32505515-32505537 CTGCACTATTTGTCTTTAGGAGG No data
988585673_988585675 -6 Left 988585673 5:32505498-32505520 CCAGTGAGAAAGAGAGTCTGCAC No data
Right 988585675 5:32505515-32505537 CTGCACTATTTGTCTTTAGGAGG No data
988585671_988585675 26 Left 988585671 5:32505466-32505488 CCCTGCTCTGTAGCGCTGGGAGC No data
Right 988585675 5:32505515-32505537 CTGCACTATTTGTCTTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988585675 Original CRISPR CTGCACTATTTGTCTTTAGG AGG Intergenic
No off target data available for this crispr