ID: 988586020

View in Genome Browser
Species Human (GRCh38)
Location 5:32508207-32508229
Sequence CTTCCAGCTCTGATGGAAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988586020_988586028 25 Left 988586020 5:32508207-32508229 CCGTTTTCCATCAGAGCTGGAAG No data
Right 988586028 5:32508255-32508277 CAGTCTGAGGCTGAGTAGGATGG No data
988586020_988586027 21 Left 988586020 5:32508207-32508229 CCGTTTTCCATCAGAGCTGGAAG No data
Right 988586027 5:32508251-32508273 CTATCAGTCTGAGGCTGAGTAGG No data
988586020_988586023 -2 Left 988586020 5:32508207-32508229 CCGTTTTCCATCAGAGCTGGAAG No data
Right 988586023 5:32508228-32508250 AGTATCCCAACTGATTCAGAGGG No data
988586020_988586022 -3 Left 988586020 5:32508207-32508229 CCGTTTTCCATCAGAGCTGGAAG No data
Right 988586022 5:32508227-32508249 AAGTATCCCAACTGATTCAGAGG No data
988586020_988586026 12 Left 988586020 5:32508207-32508229 CCGTTTTCCATCAGAGCTGGAAG No data
Right 988586026 5:32508242-32508264 TTCAGAGGGCTATCAGTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988586020 Original CRISPR CTTCCAGCTCTGATGGAAAA CGG (reversed) Intergenic
No off target data available for this crispr