ID: 988595229

View in Genome Browser
Species Human (GRCh38)
Location 5:32585004-32585026
Sequence AGAGGAATCCATATACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988595229_988595235 21 Left 988595229 5:32585004-32585026 CCTGCTTGTATATGGATTCCTCT 0: 1
1: 0
2: 1
3: 9
4: 110
Right 988595235 5:32585048-32585070 CATCTCCAGGACTTCAATACAGG 0: 1
1: 0
2: 0
3: 12
4: 98
988595229_988595237 28 Left 988595229 5:32585004-32585026 CCTGCTTGTATATGGATTCCTCT 0: 1
1: 0
2: 1
3: 9
4: 110
Right 988595237 5:32585055-32585077 AGGACTTCAATACAGGAATAAGG 0: 1
1: 0
2: 9
3: 112
4: 675
988595229_988595232 8 Left 988595229 5:32585004-32585026 CCTGCTTGTATATGGATTCCTCT 0: 1
1: 0
2: 1
3: 9
4: 110
Right 988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988595229 Original CRISPR AGAGGAATCCATATACAAGC AGG (reversed) Intronic
903641031 1:24860672-24860694 ATAGAAATGCATATATAAGCTGG - Intergenic
904130455 1:28271954-28271976 AGCTGATTCCATAGACAAGCAGG + Intronic
905465665 1:38151338-38151360 AGAGGAATACATAGAAAAGGGGG - Intergenic
906087575 1:43148914-43148936 AGAGGAATCCATATGCATGATGG - Intronic
911928663 1:103871293-103871315 AGATGAATCCATACACAACAAGG - Intergenic
913112559 1:115669591-115669613 AGAGGAAACCTTATAAAAGGTGG + Intronic
919735892 1:200950264-200950286 AGAGGAAACCATATTCATTCAGG + Intergenic
923786502 1:237073295-237073317 AGTTGAATCCATATACAACGTGG + Intronic
1064719116 10:18210285-18210307 AGAGAAATGTATATACATGCAGG + Intronic
1065970714 10:30804045-30804067 AGAGGACTCAATACACAATCTGG - Intergenic
1068051715 10:51958436-51958458 AGAGGGATACAGATACAAACTGG + Intronic
1069894867 10:71674055-71674077 AGAGGCAGCCCTATACAAGCTGG + Intronic
1070131458 10:73658215-73658237 TGAGGAACCCAAATTCAAGCTGG - Intronic
1079153742 11:17924952-17924974 AGATGAAACCATCTACAAACAGG + Intronic
1080271631 11:30456594-30456616 AGAGGAATCCATGTACTTGATGG + Intronic
1081515699 11:43826377-43826399 AAAAGAATGCATATACCAGCCGG - Intronic
1082615449 11:55354806-55354828 AAATGTTTCCATATACAAGCAGG - Intergenic
1084012230 11:66358524-66358546 TGAGAAAGCCATATACATGCAGG - Intronic
1085802499 11:79603362-79603384 AAAGAACTCCATAGACAAGCAGG - Intergenic
1087697691 11:101399012-101399034 ACAGGAAGCCATATCCAAACTGG - Intergenic
1087967574 11:104436766-104436788 AGAGGAACCCATAAACAGACTGG + Intergenic
1092124395 12:6065337-6065359 GGTGGAATGCATATGCAAGCAGG + Intronic
1095809588 12:46357675-46357697 AGAGGAATTAATGGACAAGCTGG - Intergenic
1096655510 12:53088709-53088731 ACAGAAAACCATATACCAGCCGG - Intergenic
1097158857 12:57031446-57031468 AGAGGAACCAATATGAAAGCTGG + Intronic
1099503352 12:83442246-83442268 AGATAAATCCATATACTAGTTGG + Intergenic
1100691893 12:97047220-97047242 AGAGGAATTCATTTCCAAGTTGG - Intergenic
1102541599 12:113623500-113623522 AGAGAAATCAATAAACAAACTGG - Intergenic
1107962913 13:45574865-45574887 AGATGAGTCCATTGACAAGCTGG - Exonic
1110753864 13:79147877-79147899 AGAGGACTACATGTACAAGATGG - Intergenic
1111320494 13:86621613-86621635 AAAGGAATCGATTTAAAAGCAGG - Intergenic
1114669384 14:24400653-24400675 AGAGGAAGACATTTAGAAGCCGG + Intronic
1118317173 14:64732437-64732459 ATAGGAATCCATTTCCAAGATGG - Exonic
1120677469 14:87437767-87437789 AGAGGAATAGATGTAGAAGCAGG - Intergenic
1124184083 15:27506592-27506614 GGTGAAATCCATATACCAGCAGG - Intronic
1125877386 15:43161956-43161978 AAAAAAATACATATACAAGCTGG - Intronic
1126340787 15:47638973-47638995 AGAGGAAGCCACATACAAGCAGG - Intronic
1128928140 15:71677745-71677767 AGACAAATCCATGTACAAACAGG - Intronic
1131610977 15:93963462-93963484 AGAGGATTACATTTACAAGGTGG + Intergenic
1134825746 16:17282703-17282725 ACTGGACTCCATATACAACCAGG - Intronic
1147149794 17:38508242-38508264 AGAGGAAGCCATGTTCGAGCTGG + Intronic
1150991779 17:70268146-70268168 AGAGGAATCCGTATACCATAAGG + Intergenic
1150998715 17:70349401-70349423 AGAGGCATACACATACAAGATGG - Intergenic
1154979484 18:21490839-21490861 TGAGGAATCCACATGCAAGAGGG - Intronic
1155358497 18:24977423-24977445 AGAGGCATCCCTACAGAAGCTGG - Intergenic
1155700392 18:28735928-28735950 AGAGGAAGCCACAAGCAAGCTGG + Intergenic
1164682466 19:30144936-30144958 TCAGGAATCCATAAACAGGCCGG - Intergenic
1164751715 19:30660387-30660409 AGAGGGATCCATGTAGAACCAGG - Intronic
935280162 2:101510429-101510451 TGAGGGATTCATATAAAAGCTGG + Intergenic
936050001 2:109215526-109215548 AGAGGAACCCACATAGAAGCAGG - Intronic
937363741 2:121246126-121246148 AGGGCAATCCATGTCCAAGCAGG - Intronic
939527602 2:143316837-143316859 AGAGGAGTGAATATAGAAGCAGG - Intronic
940706679 2:157114053-157114075 AAAGGAATGCTTATACATGCTGG + Intergenic
942746921 2:179244700-179244722 AGAGGAAACCACAGAAAAGCGGG + Intronic
1168889260 20:1283624-1283646 ATTGGAATACATATACATGCAGG + Intronic
1169534109 20:6518489-6518511 AGAGGAAGCCAAATATAAGCTGG + Intergenic
1170013816 20:11757730-11757752 AGAGGAACCCATATCTACGCAGG - Intergenic
1174999470 20:55611236-55611258 AGAAGAGTCCATACACAATCAGG + Intergenic
1175699421 20:61126279-61126301 AAAGGACTCAATTTACAAGCTGG + Intergenic
951113594 3:18834050-18834072 TGAGGAATCCAAAGAAAAGCAGG + Intergenic
951531567 3:23703159-23703181 AGACAAATCCATATATAAGTGGG + Intergenic
955516508 3:59731382-59731404 AGAGGAATCCAACTAGAAGATGG - Intergenic
955903209 3:63779221-63779243 AAAGAAATGCATATACTAGCAGG + Intergenic
956458305 3:69445552-69445574 ATAGGAATCCACATAGGAGCTGG - Intronic
960019724 3:112934920-112934942 AACAGAATCCAAATACAAGCAGG + Intronic
961140848 3:124554616-124554638 AGAGGAAACAAAATGCAAGCAGG - Intronic
961683040 3:128611740-128611762 GGAGGAATCCATACACACTCGGG - Intergenic
963474627 3:145789387-145789409 AGAGTATTCCAGATAGAAGCTGG + Intergenic
963683241 3:148407782-148407804 AGAGGGAACTATATACAAGCTGG - Intergenic
964797575 3:160516400-160516422 AGAGGAGTCAATAAACAAGAAGG + Intronic
965247976 3:166300026-166300048 TGAGCAATCAATATACAAGAAGG - Intergenic
966029997 3:175334334-175334356 AGAATAAACCTTATACAAGCTGG - Intronic
967161541 3:186743212-186743234 AGAGGGAGCAATATAGAAGCAGG + Exonic
970121435 4:12757618-12757640 ACAGGAATACATTTACACGCTGG + Intergenic
973241494 4:47960690-47960712 AGAGGAATGGATAAACAATCTGG + Intronic
974247263 4:59335726-59335748 AGAGAAATTCATAAACAAGAAGG - Intergenic
982055648 4:151546380-151546402 ACAGGAGTCCATCTGCAAGCTGG - Intronic
982163032 4:152588723-152588745 TGAGGAATCCATAATCAAGCAGG - Intergenic
984374786 4:178914353-178914375 AAATTAATCCATATACAACCTGG - Intergenic
988595229 5:32585004-32585026 AGAGGAATCCATATACAAGCAGG - Intronic
989015244 5:36923524-36923546 AGAAGAATGTATATAAAAGCAGG - Intronic
989735927 5:44706088-44706110 AGAGGACTCCACATAGAAGGAGG + Intergenic
990964050 5:61425553-61425575 AGAGAAATCCCCATACAACCTGG + Intronic
991218758 5:64187992-64188014 AAAGGAGTCCAAATCCAAGCAGG - Intronic
992412649 5:76521890-76521912 AGAGGAATTGATCTCCAAGCAGG - Intronic
994045107 5:95299446-95299468 AGAGGAAGCCACCAACAAGCTGG - Intergenic
996781258 5:127189237-127189259 AGAGCATTCCAGACACAAGCAGG - Intergenic
997419056 5:133751402-133751424 AGAGGAATATATTTACAAGATGG - Intergenic
999649672 5:153753256-153753278 AATGGAATACAAATACAAGCAGG + Intronic
1001672632 5:173486785-173486807 AGAGGAATCCATTTTCAATGGGG - Intergenic
1002882001 6:1261414-1261436 AGAGGAATCCAAATAGAAAGAGG + Intergenic
1004750292 6:18555643-18555665 AAAGTACTCTATATACAAGCGGG - Intergenic
1006314199 6:33280470-33280492 AGAGTAATCCATACAGAAGCCGG - Exonic
1008677089 6:53830749-53830771 AGAGGAACCCTTATACAATTAGG + Intronic
1010068389 6:71712737-71712759 AGAGGAATGCATTTAAAAGCTGG - Intergenic
1010832123 6:80543719-80543741 AGAGAATTACATGTACAAGCCGG + Intergenic
1010870574 6:81032343-81032365 AGAGAAACCCATATCCTAGCTGG - Intergenic
1012320261 6:97835587-97835609 AGAAGAAAAAATATACAAGCTGG - Intergenic
1012961783 6:105629974-105629996 AGAGAAATCCATACAGAAGAGGG - Intergenic
1019555404 7:1627230-1627252 AGTGGAATCCTCACACAAGCTGG - Intergenic
1019795925 7:3048697-3048719 AGAGGAATCAAGATACAAAATGG - Intergenic
1021355381 7:19648701-19648723 AAAGGAATTTATGTACAAGCAGG + Intergenic
1021516785 7:21498119-21498141 TGAGGAATCCACATATAAGGAGG - Intronic
1026492740 7:70876833-70876855 AAAGGACTCCATAAAAAAGCTGG + Intergenic
1027121547 7:75525873-75525895 TGAGGAACATATATACAAGCAGG + Intergenic
1030382322 7:108826440-108826462 AGAGGAAGTGATATACAAGCTGG + Intergenic
1031373502 7:120996477-120996499 AGAGGAAGCAACATGCAAGCTGG - Intronic
1033564853 7:142568592-142568614 ATAGGACTCGATATGCAAGCAGG - Intergenic
1047386558 8:124415565-124415587 AGAGTAATGGATATACAATCTGG - Intergenic
1052083521 9:24236238-24236260 AGTGGAATACGTATTCAAGCAGG + Intergenic
1052654627 9:31340487-31340509 AGAGATATCCGGATACAAGCAGG - Intergenic
1053606981 9:39670213-39670235 AGAAAAATCCAAATACAGGCGGG - Intergenic
1053864898 9:42426884-42426906 AGAAAAATCCAAATACAGGCGGG - Intergenic
1054246554 9:62672196-62672218 AGAAAAATCCAAATACAGGCGGG + Intergenic
1054560675 9:66706730-66706752 AGAAAAATCCAAATACAGGCGGG + Intergenic
1059577234 9:115503811-115503833 AGTGGAATCCAATTAAAAGCAGG + Intergenic
1060902212 9:127269294-127269316 AGATGAATCAATAAACACGCTGG - Intronic
1188289488 X:28369905-28369927 ACAGGAAACCAAATACCAGCTGG - Intergenic
1195824291 X:108981036-108981058 AGAGGAATCCAAATAGTATCTGG + Intergenic
1196079686 X:111618237-111618259 AAAGAAATGCATATAAAAGCAGG + Intergenic
1196856359 X:119989141-119989163 AGAGGAAACCAGCTACAAGATGG - Intergenic