ID: 988595230

View in Genome Browser
Species Human (GRCh38)
Location 5:32585022-32585044
Sequence GGGAGTTCACAGAAGGCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 311}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988595230_988595232 -10 Left 988595230 5:32585022-32585044 CCTCTTGCCTTCTGTGAACTCCC 0: 1
1: 0
2: 2
3: 23
4: 311
Right 988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 81
988595230_988595237 10 Left 988595230 5:32585022-32585044 CCTCTTGCCTTCTGTGAACTCCC 0: 1
1: 0
2: 2
3: 23
4: 311
Right 988595237 5:32585055-32585077 AGGACTTCAATACAGGAATAAGG 0: 1
1: 0
2: 9
3: 112
4: 675
988595230_988595235 3 Left 988595230 5:32585022-32585044 CCTCTTGCCTTCTGTGAACTCCC 0: 1
1: 0
2: 2
3: 23
4: 311
Right 988595235 5:32585048-32585070 CATCTCCAGGACTTCAATACAGG 0: 1
1: 0
2: 0
3: 12
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988595230 Original CRISPR GGGAGTTCACAGAAGGCAAG AGG (reversed) Intronic
900077447 1:828937-828959 GGGCGTCCTCAGAAAGCAAGAGG + Intergenic
900878230 1:5361410-5361432 AGGAGTCCAGAGAGGGCAAGGGG - Intergenic
902717219 1:18281037-18281059 GGGAGTTCACAGAATGGGTGAGG - Intronic
903891833 1:26574906-26574928 CAGAGTTCACAGGAGGCCAGTGG + Intronic
905203626 1:36330345-36330367 GGGAGTTCAGCCAAGGGAAGTGG - Intergenic
905618500 1:39419115-39419137 GGGAGTTGACAGAAGGAAGCAGG + Intronic
905866709 1:41380853-41380875 TGGAGTTCACAGCAGCTAAGAGG + Intronic
905887155 1:41497451-41497473 AGGAGTACCCAAAAGGCAAGTGG - Intergenic
906288169 1:44602017-44602039 GGGAGTTGGGAGAAGGGAAGAGG + Intronic
907411686 1:54287776-54287798 TGGGGTTCAAAGAAGGGAAGGGG + Intronic
909034574 1:70582297-70582319 CAGAGTTTACAGAATGCAAGGGG - Intergenic
910755834 1:90689436-90689458 GGGAATTTTCAGAAGGCAGGTGG + Intergenic
911260992 1:95685221-95685243 GGGAGGTGACAGAAGGACAGAGG - Intergenic
912843432 1:113059251-113059273 GCCAGTGCACAGAAGGCCAGAGG - Intergenic
916091192 1:161309018-161309040 GGCAGTTCAGAGAAGGGAAGGGG + Intronic
916093336 1:161326478-161326500 GGGTGTCCTCAGAAAGCAAGTGG + Intronic
916195614 1:162219504-162219526 AGGGGGTCAGAGAAGGCAAGGGG - Intronic
917745564 1:178003325-178003347 GGGAGCTGAAAGAAGGCTAGTGG - Intergenic
917852990 1:179081487-179081509 GGGAGTCCACGAAAAGCAAGAGG - Exonic
920127000 1:203701233-203701255 GGGAGTACACGGAAGGCATTTGG - Intronic
921657004 1:217751725-217751747 GGTAGTTAAAAGATGGCAAGAGG - Intronic
921881754 1:220262740-220262762 GACAGTTCACAGTAGCCAAGAGG - Intronic
923481704 1:234391134-234391156 GGGAGTACAGAGACGGAAAGCGG + Intergenic
924246602 1:242091757-242091779 GGGCGTCCACAGAAAGCAAGTGG - Intronic
924472339 1:244353587-244353609 GGGAATTCACAGGAGGGAAATGG + Intronic
1063075790 10:2714934-2714956 GGAAGGTCACAGAATGCAAATGG - Intergenic
1063125945 10:3136955-3136977 AGGAGTTCACACAGGCCAAGGGG + Intronic
1064121696 10:12624660-12624682 GGAGGTTCACAGTAGCCAAGAGG - Intronic
1064856004 10:19767811-19767833 GGGTGTTCTCAGAAAGCAAGAGG - Intronic
1065713927 10:28545555-28545577 GAGAGTACACAGAAGGGAAGAGG + Intronic
1065802515 10:29365772-29365794 GGGCATCCTCAGAAGGCAAGCGG + Intergenic
1065811906 10:29450400-29450422 GAGGGTGCACAGAAGGAAAGTGG - Intergenic
1066489906 10:35884342-35884364 GCAAGATCAAAGAAGGCAAGTGG - Intergenic
1067361143 10:45580423-45580445 GGTAGTTCACAGATGGTGAGGGG - Intronic
1068559627 10:58499038-58499060 GGGCGTCCTCAGAAAGCAAGAGG - Intergenic
1068901683 10:62276937-62276959 AGAAGTCCACAGAAGGCTAGGGG + Intergenic
1069649115 10:70030356-70030378 GGGAGTTCATGGAAGTCATGTGG + Intergenic
1069657222 10:70098951-70098973 GGGAATGTGCAGAAGGCAAGGGG - Intronic
1070237154 10:74640467-74640489 CGGAGCACACAGAAGACAAGAGG - Intronic
1070590418 10:77796782-77796804 TGGTGTTCACAGAGGGCATGGGG - Intronic
1071690454 10:87813161-87813183 AGGAGTTCTTAGAAGCCAAGGGG + Intronic
1072497314 10:95974510-95974532 GGGAGTTCCCAGAAGGGTTGGGG + Intronic
1073002539 10:100296312-100296334 GGGGTGTCAGAGAAGGCAAGGGG + Intronic
1074032528 10:109703021-109703043 TTGAGATTACAGAAGGCAAGTGG - Intergenic
1075245534 10:120818881-120818903 GTCACTTCACAGAAGGCAATGGG + Intergenic
1076334282 10:129694585-129694607 GAGAGTTCTGAGAAGGGAAGGGG - Intronic
1076435033 10:130434781-130434803 GGGAGATGACAGAAGGCCACTGG + Intergenic
1077274300 11:1696402-1696424 GGAAGTTTACAGAAGGCACAGGG - Intergenic
1078178273 11:8987320-8987342 GGGAGTTAACAGAAAGCCAAAGG + Intronic
1080449752 11:32368983-32369005 GGAGGTGCACAGAAGCCAAGAGG - Intergenic
1080769172 11:35324767-35324789 AGGATTTCACAGAAGTCCAGAGG - Intronic
1081157312 11:39710180-39710202 GGAATTTCACAGAATGGAAGAGG + Intergenic
1081492294 11:43578294-43578316 GGCTGTTGACAGAAGGGAAGGGG - Intronic
1081808114 11:45900950-45900972 GCGAATTCCCAGAAGGCAGGGGG + Intronic
1082595339 11:55072635-55072657 GGGAGCTAACTGAAGCCAAGGGG + Intergenic
1082712824 11:56575483-56575505 AGGTGTTCCCAGAAAGCAAGTGG - Intergenic
1082789003 11:57334544-57334566 GGGAGTTAACAGAAGGTATCTGG - Exonic
1083681814 11:64354893-64354915 AGGAGGTCAGAGAAGGGAAGTGG - Intronic
1083681853 11:64355024-64355046 AGGAGGTCAGAGAAGGGAAGTGG - Intronic
1084198211 11:67538366-67538388 GGGCGTCCTCAGAAAGCAAGAGG - Intergenic
1084556859 11:69880675-69880697 GGGGGTTCAGAGAAGGCCTGGGG - Intergenic
1087177826 11:95111255-95111277 GGGAATGCTCAGAAGGCAATGGG - Intronic
1090567855 11:128015325-128015347 GGGAGGTTGCAGAAGGCATGAGG + Intergenic
1093640638 12:21523561-21523583 GGAAATTCTTAGAAGGCAAGAGG - Intergenic
1094473365 12:30823274-30823296 CGCAGTTCACTAAAGGCAAGAGG + Intergenic
1096571770 12:52527568-52527590 GGCAGTTCAGAGAAGGGAGGGGG - Intergenic
1098908532 12:76186180-76186202 GGGACTTCTCAGAAGGCATTGGG - Intergenic
1099015148 12:77335622-77335644 AGAAGTTAAAAGAAGGCAAGAGG + Intergenic
1099501087 12:83415141-83415163 GGGAGGTGCCAGCAGGCAAGGGG + Intergenic
1099590457 12:84580955-84580977 GAGGGTTTACAGAAGGCAAGAGG + Intergenic
1101389627 12:104288806-104288828 GGGAGTCAACAGAGGGCACGCGG + Intronic
1102466217 12:113132318-113132340 GGGAGTTCACAGTTTGGAAGTGG - Intronic
1102496595 12:113323811-113323833 GGGAGTTCAGAGAGGGCTTGTGG - Intronic
1102628986 12:114260344-114260366 GGGAATTCAAAGAAGACAAGAGG - Intergenic
1102709828 12:114916126-114916148 GGGATTTCTCTGCAGGCAAGCGG - Intergenic
1104151804 12:126091241-126091263 GGGTGGTCACAGGAGGCAGGAGG - Intergenic
1104187071 12:126443088-126443110 GGGTGTCCTCAGAAAGCAAGAGG + Intergenic
1104210485 12:126683976-126683998 GTGGGTGCACAGAAGACAAGGGG - Intergenic
1105429222 13:20321955-20321977 GGGTGTCCTCAGAAAGCAAGAGG + Intergenic
1105709513 13:22993146-22993168 GGGAGTACAGAGAAGACAAAGGG - Intergenic
1105962254 13:25352864-25352886 GGGTATCCTCAGAAGGCAAGAGG + Intergenic
1106366196 13:29083216-29083238 AGGAGTTCACAGAAGAGAAATGG - Intronic
1106645769 13:31632223-31632245 GGGAGTCCACAGAACTCATGTGG - Intergenic
1106654323 13:31726083-31726105 GGCATTTCACAGGTGGCAAGTGG + Intergenic
1107879793 13:44822932-44822954 CGGAGTTCACAGAAGGCTTTCGG - Intergenic
1108591593 13:51917360-51917382 GGGTGCTCACAGAAGGAAAGAGG + Intergenic
1109162336 13:58991246-58991268 GGGAGTTACTAGAAGGGAAGTGG - Intergenic
1109616208 13:64837157-64837179 GTGGGTACACAGAAGACAAGAGG + Intergenic
1113079097 13:106498178-106498200 GGCAGTGCACAGAAAGAAAGGGG + Intronic
1114850380 14:26376359-26376381 GAGAATTCACAGAGGGCAAAGGG - Intergenic
1115693912 14:35876127-35876149 GAGAGGTCACAGAAGGCACCAGG - Intronic
1116343012 14:43750811-43750833 GGGTGTTCTCAGAAAGCAAGAGG + Intergenic
1118529935 14:66692560-66692582 GAGAGAACACAGAAAGCAAGTGG + Intronic
1119558065 14:75568523-75568545 GGCAGTTCCCAGAAGGAGAGGGG - Intergenic
1119798360 14:77419835-77419857 GGGAGTTCCCAGAAGACTATTGG - Intronic
1120409486 14:84134423-84134445 CGGAGTTCACAGAAGTTATGTGG - Intergenic
1120797609 14:88652225-88652247 GGGAGGTCACCTAAGGAAAGGGG - Intronic
1122429382 14:101630287-101630309 GGGAGCCCCCAGAAGACAAGTGG + Intergenic
1124709358 15:31992801-31992823 GAGAGATCACAGTAGGCAAAAGG - Intergenic
1124859227 15:33422103-33422125 GGAAGTTCTGAGAAGGCAAGTGG - Intronic
1124967917 15:34451829-34451851 GGGAGTTCACAGAAAATAAATGG + Intergenic
1125754703 15:42055583-42055605 GGGAGATCACATAGGGAAAGGGG + Intergenic
1126309606 15:47300769-47300791 GGGACTGCACAGAAGGCAGATGG - Intronic
1126824477 15:52535648-52535670 GAGAGTTTATAGAAAGCAAGGGG - Intergenic
1127457126 15:59165276-59165298 TGGAGTTCACTGGAAGCAAGAGG + Intronic
1127872732 15:63086977-63086999 GGGAGTTCATGGAAGGCGACAGG + Intergenic
1128062315 15:64742812-64742834 AGGAGTTCCCAGCAGCCAAGTGG - Intronic
1128500983 15:68227607-68227629 GGGAGCTCACACAGGGGAAGAGG + Intronic
1128903702 15:71448985-71449007 GAGAATGAACAGAAGGCAAGGGG - Intronic
1129070267 15:72945210-72945232 GGGAGTCCACAGTAGGAATGTGG - Intergenic
1129120545 15:73393818-73393840 GGGAGAGGACAGAAAGCAAGTGG + Intergenic
1129198805 15:73986518-73986540 GGGAGGTCACAGATGAGAAGAGG + Intronic
1129950059 15:79578112-79578134 GGGAGTCTACAGAGAGCAAGAGG - Intergenic
1130041882 15:80411895-80411917 GGGTCTTCTCAGAAGGGAAGTGG + Intronic
1133014728 16:2934076-2934098 GGATGTTCAAAGAAGGGAAGAGG - Intronic
1133678803 16:8100902-8100924 TGCAGCTCACTGAAGGCAAGGGG + Intergenic
1135046126 16:19157373-19157395 TGGAGTTCAGAGAAGGCATCCGG + Intronic
1135325251 16:21521522-21521544 GGAAGCTCACAGCAGGCATGTGG + Intergenic
1135422451 16:22314198-22314220 GGGTCTTCACAGAATGCAGGTGG + Intronic
1135998113 16:27268642-27268664 GGGACTTCAAGGAAGGCGAGGGG - Intronic
1136336736 16:29614790-29614812 GGAAGCTCACAGCAGGCATGTGG + Intergenic
1138578857 16:57926513-57926535 GCGAGTTGGCAGAAGGCAACAGG - Intronic
1140720154 16:77764286-77764308 GGGAGTATACAGGAGGCATGGGG + Intergenic
1141475212 16:84268351-84268373 GGGAGTACAGATAAGGCAGGCGG - Intergenic
1141961584 16:87412713-87412735 GTGAGTGCACAGAAGACGAGAGG + Exonic
1142037462 16:87870574-87870596 GGAAGCTCACAGCAGGCATGTGG + Intergenic
1142782242 17:2190257-2190279 GGGAGTTGGGAGAAGACAAGTGG + Intronic
1143216975 17:5232504-5232526 GGGAGTCCACAGAAGTCCTGGGG + Intronic
1143480487 17:7225083-7225105 GGGAGTATTCAGAAGCCAAGTGG - Exonic
1144255873 17:13466652-13466674 GGGAGTTCACAGACTGAAATGGG - Intergenic
1144628197 17:16856270-16856292 GGGAGTGCACAGAGGGCTGGGGG + Intergenic
1144655113 17:17030167-17030189 GGGAGTGGACAGAAGGCTGGGGG - Intergenic
1144946718 17:18973136-18973158 TGGAGGGCACAGTAGGCAAGTGG + Intronic
1145159789 17:20566837-20566859 GGGAGTGCACAGAGGGCTGGGGG + Intergenic
1145816265 17:27797211-27797233 GGGGCTTCACAGAAGTCAGGTGG - Intronic
1146178097 17:30679567-30679589 GGGAGGACAGAGAAGGCAGGAGG + Intergenic
1146569349 17:33939430-33939452 TGAAGTTCAGAGAAGGGAAGAGG + Intronic
1148216467 17:45836316-45836338 GGGAGTACAGAGAGGGCAACAGG + Intergenic
1149878589 17:60264629-60264651 GGGAGATCACTGGAGGCCAGGGG + Intronic
1150416515 17:64993198-64993220 GGGAGATCACAGACGCCATGGGG - Intergenic
1150441657 17:65196576-65196598 GGGAGTGCAGAGATGGCAAATGG + Intronic
1150795147 17:68230698-68230720 GGGAGATCACAGATGCCATGGGG + Intergenic
1152164692 17:78694989-78695011 GGGAGGTCACAGGAGGCCTGAGG - Intronic
1152280961 17:79384665-79384687 GGAAGTCCACAGACGGCCAGGGG + Intronic
1152468896 17:80480130-80480152 GGGAGTGTAGAGAAGGCAAAGGG + Intergenic
1153604816 18:6821896-6821918 GGTAAATCACAGAAGACAAGGGG - Intronic
1153929368 18:9865265-9865287 AGACCTTCACAGAAGGCAAGAGG - Intergenic
1155046906 18:22110629-22110651 GGCAGTTTACAGAATGCAGGAGG - Intergenic
1155811028 18:30235488-30235510 GGGAGTCCTCAGGAAGCAAGAGG - Intergenic
1156133662 18:34008834-34008856 GGGAGTTCAGGGAAGCCAAATGG + Intronic
1157733503 18:50025394-50025416 AGGGGATCACAGAGGGCAAGGGG - Intronic
1158184373 18:54754552-54754574 GGGCGTCCTCAGAAAGCAAGTGG + Intronic
1159108689 18:64031550-64031572 GGGAGTGCAGAGAAGGGAGGAGG - Intergenic
1159885264 18:73897639-73897661 GGGAGTTCACAGAACACCATGGG - Intergenic
1160911581 19:1476352-1476374 GGGCGCTCACAGAAGGTAGGGGG - Intronic
1162345176 19:10114544-10114566 GGGTGGACACAGAAGGCCAGGGG - Exonic
1162792918 19:13072284-13072306 GGGAGCTCACAGAGGGCTGGGGG - Intronic
1163071217 19:14843618-14843640 AGGAATTCAGAGATGGCAAGGGG - Intergenic
1163201996 19:15776310-15776332 GGGGCTTCACAGAAGCCTAGGGG + Intergenic
1163252213 19:16132704-16132726 GCGAGGTCCCAGAAGGCCAGCGG + Exonic
1165613171 19:37174821-37174843 GGGTGTCCTCAGAAAGCAAGTGG - Intronic
1166772762 19:45294267-45294289 GGGAGGGCAGAGAAGGGAAGAGG + Intronic
1167202397 19:48075013-48075035 GGGGGTCAGCAGAAGGCAAGGGG - Intronic
1168500408 19:56888247-56888269 GGGAGTATAGAGAAGGAAAGGGG - Intergenic
924997241 2:373351-373373 GGGAGTTCACAGAAGGTCAGGGG + Intergenic
926560970 2:14417033-14417055 GGGAGGTGGCAGAAGGAAAGGGG - Intergenic
926620070 2:15039594-15039616 GGGAGCTAACAGAAGGTGAGGGG + Intergenic
928873722 2:36012244-36012266 AGGAGTTAATAAAAGGCAAGAGG - Intergenic
929692498 2:44086521-44086543 GGGAGGTGAAAGAAGGCGAGTGG - Intergenic
930108530 2:47658555-47658577 GGGGATTCCCAGAAGGGAAGGGG + Intergenic
931382832 2:61769343-61769365 GGAGGTTCACAGAAGTAAAGTGG - Intergenic
933230433 2:79801181-79801203 GGGAGTGCACAAGAGGCAAGAGG - Intronic
934732002 2:96665304-96665326 GGGAGTTCACAGGAGGGAGAAGG - Intergenic
934768022 2:96891481-96891503 GGGAGTTCAGAGAAGGACAAAGG + Intronic
936268122 2:111026834-111026856 GGGTGTCCTCAGAAAGCAAGAGG + Intronic
936539960 2:113341725-113341747 GGGAGTTCACAGGATGCACAAGG - Intergenic
938441281 2:131336094-131336116 TGGGGTTCAGAGAAGCCAAGGGG - Intronic
938983566 2:136550283-136550305 AGGAGATCATAGAAGGGAAGAGG - Intergenic
940052863 2:149482563-149482585 GGGAGCTCAGAGAATGGAAGGGG - Intergenic
940112419 2:150169442-150169464 GAGAGTTCCCAGAAGGCCACTGG + Intergenic
940239640 2:151549123-151549145 CCCAGTTCACAGAAGGCTAGAGG - Intronic
940966969 2:159849368-159849390 GGGAAGTCAGAGAAGGGAAGAGG - Intronic
941294308 2:163717009-163717031 GGGTGTTTGGAGAAGGCAAGTGG - Intronic
943328779 2:186533849-186533871 GGGAGCTCACAAAAGGAGAGGGG + Intergenic
943751593 2:191514963-191514985 GAGAGTTCAGAGATGGAAAGGGG + Intergenic
945119988 2:206447528-206447550 GGGAGGTCACAGAACACAAAGGG - Intronic
946152249 2:217784571-217784593 GGGAGTTCAACGAAGGCATCTGG - Intergenic
946230473 2:218287964-218287986 GGGAGTACAGATAAGGGAAGAGG + Intronic
946436878 2:219662914-219662936 GGAAATGCACAGTAGGCAAGGGG + Intergenic
947136409 2:226980465-226980487 GGAAGTTCAGAGAAGGTAAATGG - Intronic
947460250 2:230297979-230298001 AGGAGTACATACAAGGCAAGGGG + Intronic
947546494 2:231014380-231014402 GGGTGTCCTCAGAAAGCAAGAGG - Intronic
947948123 2:234124143-234124165 GGGCATTCTCAGAAGGCAGGAGG + Intergenic
1168844387 20:933830-933852 GGGTGTTCTCAGAAAGCAAGAGG + Intergenic
1168896754 20:1328979-1329001 GGGAAGTCCCAGAAGGGAAGGGG + Intronic
1169236665 20:3935296-3935318 GGGAGAAGACAGAAAGCAAGAGG + Intronic
1169296170 20:4401961-4401983 GGCAGTTTACAGAAGACATGGGG + Intergenic
1169419769 20:5450548-5450570 GGGTGTCCTCAGAAAGCAAGCGG + Intergenic
1169484263 20:6013449-6013471 GGCAGGTCACAGAAGGTGAGAGG + Intronic
1170021474 20:11841100-11841122 GGGATCTCACAGAAGACAAATGG + Intergenic
1170233442 20:14075600-14075622 GGGAAATCAAAGATGGCAAGGGG - Intronic
1170560154 20:17550262-17550284 GGGTGTCCTCAGAAAGCAAGAGG + Intronic
1172018949 20:31899173-31899195 GGAAGTTCAGAGATGGTAAGGGG + Intronic
1172614648 20:36275239-36275261 GGCAGTTCCCAAAAGGCAGGAGG + Intergenic
1172777208 20:37414666-37414688 GGGAGTTGGCAGAAGGGAATGGG - Intergenic
1172941671 20:38658662-38658684 TGGAATTGAGAGAAGGCAAGCGG + Intergenic
1175243655 20:57568178-57568200 GGAAGCTCACAGAAGGCAAGAGG + Intergenic
1175369565 20:58478838-58478860 GGGAGTTCCCAGCAGGCTGGGGG + Intronic
1178948074 21:36964728-36964750 TGTAGTTAACAGAAGGCCAGCGG + Intronic
1179274095 21:39875578-39875600 GGAAAGTCATAGAAGGCAAGAGG - Intronic
1181719271 22:24761374-24761396 GGGAGTTGACAGGAGAAAAGAGG + Intronic
1183036527 22:35144723-35144745 GGAAGTTCCAAGAAGGCAAAAGG - Intergenic
1183516467 22:38269727-38269749 GCCAGTTCCCAGCAGGCAAGGGG + Intronic
1184336231 22:43854820-43854842 AGGTGGTCTCAGAAGGCAAGGGG - Intronic
1184416955 22:44357805-44357827 GGAGGCTCAGAGAAGGCAAGGGG - Intergenic
1184476016 22:44721857-44721879 GGGTCTTCATAGAAGGCATGAGG - Intronic
1184828010 22:46966123-46966145 GAAAGTTCACAGACGGAAAGAGG - Intronic
950043057 3:9932755-9932777 GGGAGTTCTCCGAGGGAAAGCGG + Intronic
950394633 3:12724547-12724569 AGGGGTTCACAGAAGCCAAGGGG - Intergenic
951259550 3:20490737-20490759 GAGATTTCAAAGAAGACAAGAGG - Intergenic
951575814 3:24112709-24112731 CTGAGTTCAGAGAAGGCAAGAGG - Intergenic
951730840 3:25808698-25808720 GGAAGACCACAGAAGGCAAAGGG - Intergenic
952280850 3:31921907-31921929 GGAAGATCACAGAGGGAAAGTGG - Intronic
953465624 3:43116819-43116841 GGAAGTTCACTGAAGCCATGGGG - Intergenic
953799304 3:46009755-46009777 GGGCGTCCTCAGAAAGCAAGAGG + Intergenic
954443382 3:50533935-50533957 AGGAGGCCCCAGAAGGCAAGGGG - Intergenic
956096832 3:65725283-65725305 TGGGGTACACAGAAGTCAAGTGG - Intronic
956345240 3:68271079-68271101 GGGACATGACAGGAGGCAAGGGG + Intronic
956818830 3:72933945-72933967 GGGAGTTCTCAGAATGAAAGAGG + Intronic
958560497 3:95742816-95742838 GTGGGTGCACAGAAGACAAGAGG - Intergenic
959151112 3:102609388-102609410 GGGAATTTAGAGAAGGAAAGTGG - Intergenic
960945629 3:122964517-122964539 GGGATTTCAAAAAATGCAAGTGG - Intronic
963407144 3:144880492-144880514 GGGAGTTCACAGTTGACAAAGGG - Intergenic
963445059 3:145395297-145395319 GGCAGTGCAGAGAAGGGAAGGGG + Intergenic
964737987 3:159935639-159935661 TGGCATTCACAGAAGGCAGGAGG - Intergenic
964793565 3:160474834-160474856 GGGCGTGAGCAGAAGGCAAGGGG - Intronic
965680516 3:171246747-171246769 TGGAGTTTTCAGAAGGCAGGCGG + Intronic
967130710 3:186468092-186468114 GAGAGATCACAGAGGCCAAGAGG + Intergenic
967390415 3:188948946-188948968 AGGAGTACACACAAGGCCAGAGG - Intronic
969608366 4:8213355-8213377 CGGAGTTCACAGAGGCTAAGAGG - Intronic
970837824 4:20432150-20432172 GCCAGTTCACCGAAGGCAAAAGG - Intronic
971142769 4:23942710-23942732 GTGAGTTCACAGATGCCAAATGG - Intergenic
972584005 4:40419924-40419946 GGGAGTTTCCAGAAGGCAGAGGG + Intergenic
975411490 4:74056640-74056662 GTGAGTTGACAGTAGGAAAGAGG + Intergenic
975937795 4:79602295-79602317 GGGAGTTGAGGGAAGGGAAGTGG - Intergenic
979281441 4:118872633-118872655 GGGTGTCCTCAGAAAGCAAGAGG - Intronic
980076877 4:128303297-128303319 AGGAGTTCACAGAAGAAAAAAGG - Intergenic
980980050 4:139647093-139647115 GTGAGATCACATAAGGCCAGTGG - Intergenic
986456760 5:7927633-7927655 AGGTGTGCACAGAAGGCAGGTGG + Intergenic
988595230 5:32585022-32585044 GGGAGTTCACAGAAGGCAAGAGG - Intronic
991297813 5:65100306-65100328 GGGCGTCCTCAGAAAGCAAGAGG + Intergenic
993589207 5:89773307-89773329 GGGAGAACACAGGAGGAAAGGGG + Intergenic
993603058 5:89952797-89952819 GGGTGTCCACAAAAGGCCAGTGG + Intergenic
998567933 5:143232555-143232577 GGGAGGTCACACAAGCCAGGTGG + Intergenic
999065874 5:148684888-148684910 GGAGGTTAAGAGAAGGCAAGAGG + Intergenic
999133541 5:149302322-149302344 AGGAGCTCGCAGAAGGCAGGAGG - Intronic
999317175 5:150591477-150591499 TGGAGTTCACAGATGGGAAAGGG + Intergenic
1000602189 5:163288146-163288168 GGGTGCTCACAGAATCCAAGGGG + Intergenic
1002562720 5:180093193-180093215 GGGAGTACACAGACAGCAAAAGG - Intergenic
1006270140 6:32958122-32958144 GGGTGGTAACAGAAGGCATGTGG - Intronic
1007272043 6:40645245-40645267 GGAAGCTCAGAGAAGGCAAGTGG - Intergenic
1008379142 6:50823095-50823117 GGGAGTGCAAAGCAGGCAAAAGG - Intronic
1010541096 6:77093403-77093425 GGGTGTTCTCAGAAAGCAAGAGG - Intergenic
1012383415 6:98648326-98648348 AGGAGTTCTCACACGGCAAGGGG - Intergenic
1014426462 6:121312880-121312902 GGGAGTCCTCAGAAAGCAAGTGG - Intronic
1015017973 6:128437378-128437400 GGGTGTCCTCAGAATGCAAGAGG - Intronic
1015062234 6:128980439-128980461 GACCATTCACAGAAGGCAAGAGG + Intronic
1015594328 6:134851737-134851759 GTGAGTTAACAGAAGGCAGGCGG + Intergenic
1016662800 6:146600392-146600414 GGGAGTGGAGAGAAGGCTAGTGG - Intronic
1017525086 6:155235345-155235367 AGGAGTGCACAGAAGGCTGGGGG + Intronic
1017816217 6:158018305-158018327 GCCAGGTCACAGATGGCAAGGGG - Intronic
1017830249 6:158120777-158120799 GGGACCTCAAAGAAGGAAAGAGG + Intronic
1019235811 6:170611407-170611429 GGGCGTCCTCAGAAAGCAAGAGG - Intergenic
1020218981 7:6219658-6219680 GGGATTTCACAGGGGACAAGAGG - Intronic
1022259614 7:28691575-28691597 GGGACTTCCAAGGAGGCAAGTGG + Intronic
1022784953 7:33629034-33629056 GGGAATTCAAGGAAGGAAAGGGG + Intergenic
1022975619 7:35553373-35553395 GGGAGTTTTCAGTAGGCAGGTGG - Intergenic
1023050532 7:36247227-36247249 GGGAATTTTCAGAAGGAAAGAGG + Intronic
1023563513 7:41500484-41500506 GGGCCTCCACAAAAGGCAAGTGG + Intergenic
1024910243 7:54439122-54439144 GGGAGATCACTGAATGTAAGTGG + Intergenic
1025533762 7:61922613-61922635 GGGAGCCCACAGAAGGCTATGGG + Intergenic
1026763658 7:73145623-73145645 GGGATTTCAGAGAAGGCAGCAGG - Intergenic
1027040128 7:74955393-74955415 GGGATTTCAGAGAAGGCAGCAGG - Intergenic
1027083511 7:75246963-75246985 GGGATTTCAGAGAAGGCAGCAGG + Intergenic
1027812133 7:82916555-82916577 GGGAATTAACAGGAGGAAAGAGG - Exonic
1028768525 7:94588404-94588426 GGAACTTCACTGAAGGAAAGGGG + Intronic
1029013554 7:97289522-97289544 GGGAGTACACAAAAGGAAAATGG - Intergenic
1029391112 7:100274845-100274867 GGGATTTCAGAGAAGGCAGCAGG + Intergenic
1029485401 7:100836840-100836862 GGGAGTTTACAGCAGGAATGGGG + Intronic
1031968749 7:128048167-128048189 TGGACTTCAGAGAATGCAAGAGG + Intronic
1032219311 7:129982036-129982058 AGGAGCTCAGAGAAGGCATGAGG + Intergenic
1032546797 7:132750731-132750753 GGGAGTGGAGAGAAGGGAAGAGG - Intergenic
1033641681 7:143267985-143268007 CTGAGTTCACAGAAGCAAAGAGG - Intronic
1034487471 7:151374896-151374918 GGGGGTGCACAGGAGGCAGGGGG + Intronic
1035047139 7:155974888-155974910 TGAAGTTCACAGAAGGGATGTGG + Intergenic
1035473900 7:159128974-159128996 GGGAGCTCACAGGAGGGAGGGGG - Intronic
1035515729 8:230951-230973 GGGCGTCCTCAGAAAGCAAGAGG - Intergenic
1036183371 8:6603777-6603799 TGAAGTTCAGAGAATGCAAGTGG - Intronic
1037420189 8:18693786-18693808 GGTAGTTCACAGAATGGAGGAGG - Intronic
1037615384 8:20514482-20514504 GGGAGGACACAGGAGACAAGGGG - Intergenic
1037626913 8:20616094-20616116 AGGAATTCTAAGAAGGCAAGTGG - Intergenic
1039263755 8:35802319-35802341 GTGAGTTCAGAGAAGTGAAGGGG + Intergenic
1045327410 8:101127143-101127165 GGAACTTCACAAAATGCAAGTGG - Intergenic
1047390709 8:124448543-124448565 GGGTGTTCTCAGAAGGCGAGAGG + Intergenic
1047408909 8:124608328-124608350 GGAAGTTGCCAGAAGGCAATGGG + Intronic
1048293530 8:133198044-133198066 GTGAGTACAGAGAAGGCAAGTGG - Intronic
1048554952 8:135466660-135466682 GTCAGTAAACAGAAGGCAAGAGG - Intronic
1049015639 8:139918205-139918227 GTGAGTTCAGAGAAGGCCAAGGG + Intronic
1049847150 8:144808352-144808374 GGGAGGACACAGAGGGCAGGCGG + Exonic
1051864715 9:21666804-21666826 GGGACTTCACAGATGTCATGGGG - Intergenic
1052037226 9:23696280-23696302 GGGAGCTCAGAAAAGGCAACGGG + Intronic
1053311550 9:37023980-37024002 GAGGGTTCACAGAAGGGGAGAGG - Intronic
1053480877 9:38415396-38415418 GGGAGGAGACAGAAGGCAGGAGG + Intronic
1055762774 9:79627016-79627038 GTGAGTACAAAGAAAGCAAGTGG + Intronic
1056682218 9:88729677-88729699 AGGTGTTCAACGAAGGCAAGTGG - Intergenic
1058078503 9:100675641-100675663 GGGAATTCACAGATGTCAAATGG - Intergenic
1058706306 9:107640552-107640574 GGGAGTTCACTGAGGGGACGGGG - Intergenic
1059739441 9:117135427-117135449 GGGAGCTCACAGTATGCAAACGG - Intronic
1060742207 9:126106687-126106709 GGAGGTTCACGGAAGTCAAGCGG - Intergenic
1060951079 9:127603567-127603589 GGGTGTCCCCAGAAAGCAAGAGG - Intergenic
1062618353 9:137408014-137408036 GGGAGACCACAGGAGGCATGAGG - Intronic
1186463645 X:9767511-9767533 GGGACCCCACAGAAGGCAGGCGG + Intronic
1187433084 X:19242403-19242425 GGGAGTTCATATGAGCCAAGAGG + Intergenic
1189259630 X:39669203-39669225 GGGAGGTCAGAGAGGGAAAGGGG - Intergenic
1190131284 X:47751131-47751153 GGGTGTCCTCAGAAAGCAAGAGG - Intergenic
1190416795 X:50188142-50188164 GGGCGTCCTCAGAAAGCAAGAGG + Intergenic
1190779975 X:53584495-53584517 GAAAGTCCCCAGAAGGCAAGTGG + Intronic
1191586711 X:62834726-62834748 GTGAGTTCTCAGATGGAAAGGGG - Intergenic
1192273300 X:69604835-69604857 GGGGCTTCTCAGAAGTCAAGTGG + Intergenic
1192803935 X:74493571-74493593 GGGCCATCCCAGAAGGCAAGAGG - Intronic
1195707223 X:107746302-107746324 GGGAGTGCAGAAAAGGGAAGAGG + Intronic
1198631656 X:138645542-138645564 GGAAGATCACAGAAGGCATGGGG + Intronic
1199825752 X:151497947-151497969 GGGAGATCACAGAAGGGCACTGG - Intergenic
1199827641 X:151515857-151515879 GGGAGATCACAGAAGGGCATTGG - Intergenic
1199963843 X:152801522-152801544 GGGAGATCACAGAAGGGAATTGG + Intergenic
1200965482 Y:9032192-9032214 GGGAGTCCCAAGATGGCAAGTGG + Intergenic
1201429098 Y:13887603-13887625 GGAAGTTCACAGAATGCAGGGGG + Intergenic