ID: 988595232

View in Genome Browser
Species Human (GRCh38)
Location 5:32585035-32585057
Sequence GTGAACTCCCTTACATCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988595229_988595232 8 Left 988595229 5:32585004-32585026 CCTGCTTGTATATGGATTCCTCT 0: 1
1: 0
2: 1
3: 9
4: 110
Right 988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 81
988595230_988595232 -10 Left 988595230 5:32585022-32585044 CCTCTTGCCTTCTGTGAACTCCC 0: 1
1: 0
2: 2
3: 23
4: 311
Right 988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988595232 Original CRISPR GTGAACTCCCTTACATCTCC AGG Intronic
905630500 1:39515511-39515533 TTGAACTCCCTCACCTCTCGGGG - Intronic
905667261 1:39770678-39770700 TTGAACTCCCTCACCTCTCGGGG + Exonic
906917340 1:50024939-50024961 TTGAACTCTCTCACATTTCCTGG + Intergenic
907173148 1:52490948-52490970 GCGAAATCTCTTACCTCTCCTGG + Intronic
908150488 1:61296296-61296318 TTAAACTCCCTTGAATCTCCAGG + Intronic
910820842 1:91344230-91344252 CTGAACTATCTTATATCTCCTGG - Intronic
913415793 1:118605539-118605561 GTGAACTTCCTTTCATCTTGAGG - Intergenic
915074288 1:153296134-153296156 GAGAATTCCCTTCCCTCTCCAGG + Intergenic
922073181 1:222216507-222216529 AAGAACTCCCTTACATTTCCAGG + Intergenic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1066644931 10:37596764-37596786 TTGAACTCCCTTAAACCTACTGG - Intergenic
1066978574 10:42390988-42391010 GGAAACTCCCTCACCTCTCCAGG - Intergenic
1067685710 10:48465098-48465120 CTGAACTCCCTCAGCTCTCCTGG + Intronic
1069786163 10:70989192-70989214 GTCACCTCCATTACATTTCCAGG - Intergenic
1076324217 10:129608841-129608863 GGCCACTCCCTTTCATCTCCCGG + Intronic
1076935450 10:133565648-133565670 GAGAATTACCTCACATCTCCAGG - Intronic
1080823997 11:35832601-35832623 GAGAGCTCCCTTACCTCTTCTGG + Intergenic
1083141535 11:60725849-60725871 GGGAACTGCCTTATATCTACAGG + Intergenic
1084973380 11:72783309-72783331 GTGAATGACCTTAGATCTCCAGG + Intronic
1088205975 11:107393004-107393026 GTGGATTGCCTTAAATCTCCTGG + Intronic
1088871599 11:113894775-113894797 GTGAACTCCCAGATATTTCCTGG - Intergenic
1089761744 11:120731387-120731409 TTGAACTCCCTTGCATCCCTGGG + Intronic
1093794741 12:23297972-23297994 GAGAACTCTCTTAAATCTCCAGG + Intergenic
1095339818 12:41076183-41076205 CTGAACTCCCTCACATGTTCGGG + Intergenic
1097691171 12:62735898-62735920 GAGAACTACCTTCCATTTCCAGG - Intronic
1098078145 12:66755751-66755773 GTGAATTCCCTGACATTTCCAGG - Intronic
1101073121 12:101097144-101097166 ATGAATTCCCTTACATCTGGAGG + Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1112306511 13:98279697-98279719 GTGATGTCCCTGACATCCCCTGG - Intronic
1114515010 14:23293517-23293539 GAGAACCCACTTACCTCTCCTGG + Intronic
1115314056 14:32007956-32007978 GTGAACTCCCTGACAGTTCTAGG + Intronic
1121362500 14:93274439-93274461 GTTCACTCCCTTGCATCTCATGG - Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1127078170 15:55348523-55348545 GAGAACTCACTTACTACTCCAGG - Intronic
1128262129 15:66239834-66239856 ATTAACTCCCTTGCACCTCCGGG - Intronic
1128675721 15:69607146-69607168 GTGTTTTCCCTTACATCTTCAGG + Intergenic
1134784586 16:16930225-16930247 GTGAGTTACCTTACATCTCTGGG - Intergenic
1138314418 16:56056633-56056655 ATGAACTCCCCTGCATGTCCAGG + Intergenic
1144791117 17:17859985-17860007 GGGAAGTCACTCACATCTCCTGG + Intronic
1145179728 17:20736501-20736523 TTGATCTCCCTTTCATTTCCAGG - Intergenic
1150142299 17:62740303-62740325 GTGAAGTGCCTGCCATCTCCAGG + Intronic
1155555097 18:27010235-27010257 GTGACCTCCCTTAAGTCCCCAGG - Intronic
1164388985 19:27801331-27801353 TTGAACACTCTTACATCTCACGG + Intergenic
931127848 2:59297494-59297516 GCCATCTCCCTTACATCTCAGGG - Intergenic
944685896 2:202117493-202117515 TTGTCCTCCCTTACATCTCTCGG - Intronic
945664044 2:212720083-212720105 GTGAACTCCCCTCCAGCACCAGG - Intergenic
948785579 2:240350742-240350764 GTGTCCTCTCTTACAGCTCCGGG - Intergenic
1171976352 20:31597132-31597154 GTGCACTCCCTTTTATCACCAGG + Intergenic
1174637837 20:52017281-52017303 ATGAACTCAATTACATCTCATGG + Intergenic
1178621655 21:34182612-34182634 GTTGACTCCCTTACACTTCCAGG - Intergenic
1184119995 22:42443974-42443996 GTGAACTCCCAAACGACTCCCGG - Intergenic
953216865 3:40926936-40926958 GTTAACTCCCTTGCATTTCCAGG + Intergenic
953576611 3:44117698-44117720 GCGAGCTCCCTTACATCATCAGG - Intergenic
961959044 3:130834587-130834609 CTGAACTACCTTACAGCCCCTGG - Intergenic
964403583 3:156325088-156325110 GTGAAATACCTTACACCTACTGG + Intronic
965645398 3:170875268-170875290 GTTAACTCCCTTGCATTTTCAGG + Intergenic
967696733 3:192541677-192541699 AAGAACTCCCTTACATTTCTTGG + Intronic
967853878 3:194101923-194101945 GTGCTCTCCCTTGCTTCTCCAGG - Intergenic
969220233 4:5754340-5754362 GGGAACTCCCTTCCTTCTCCTGG - Intronic
974570971 4:63648545-63648567 GTCAGCTCCCTTACATTTCCAGG - Intergenic
977503322 4:97868634-97868656 GTGTACTCCTTTACATTTTCTGG + Intronic
978435252 4:108677022-108677044 GGGAACTTCCTTACCTCTCAAGG + Intergenic
979124166 4:116946529-116946551 GGGAACTCACTTACATCTGAGGG - Intergenic
979966057 4:127077579-127077601 GGGAACTCCCTCCCCTCTCCAGG - Intergenic
984191273 4:176608583-176608605 TTGAATTTCCTTACATCTCCAGG - Intergenic
984640318 4:182157759-182157781 TGGAACGCCCTTACCTCTCCTGG - Intronic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
991295119 5:65072373-65072395 CTGAAGTCCCTCACATCTTCTGG + Intergenic
991531378 5:67618932-67618954 CTGAACTACCTTTCAGCTCCAGG + Intergenic
1006559609 6:34899128-34899150 CTGAGGCCCCTTACATCTCCTGG + Intronic
1007840520 6:44712380-44712402 GAGGCCTCCCGTACATCTCCAGG - Intergenic
1010516615 6:76780740-76780762 TTGTACTTGCTTACATCTCCAGG + Intergenic
1015513756 6:134064682-134064704 GTGAATACCCTTCCATGTCCAGG - Intergenic
1021075940 7:16304782-16304804 GTGAACTCCCTGACTTTTCAGGG + Intronic
1021775243 7:24048070-24048092 GTGAAATCCCTTACATTGACGGG + Intergenic
1022529319 7:31057278-31057300 GTGCACTCCCTGACTCCTCCAGG + Intronic
1023885161 7:44349055-44349077 GTGAACACCCTTATGTCTCTGGG - Intergenic
1027249472 7:76389997-76390019 GTGACCTCCCTTCCTCCTCCAGG - Exonic
1037652545 8:20852044-20852066 GTGTACACCCTTATTTCTCCAGG + Intergenic
1039720166 8:40155422-40155444 GTGAATTACCTCACATCTGCTGG + Intergenic
1043406535 8:79940379-79940401 GTGAACTCCTTTACTGTTCCAGG + Intronic
1049959926 9:728563-728585 GTGAATCCCCTTACCTGTCCAGG + Intronic
1057223148 9:93268507-93268529 GTGAACTCCTTTACACCTATGGG - Intronic
1189273704 X:39769726-39769748 GTTAACTCCCCTACAGCTCCAGG + Intergenic
1189740489 X:44112692-44112714 CTGAGCTCCCTTTCATCTCAAGG + Intergenic
1190161324 X:48033491-48033513 GTGTACACCCTTACAACTCCTGG + Intronic
1195926117 X:110026491-110026513 TTGGACTCCAATACATCTCCAGG - Intronic
1197234509 X:124044453-124044475 CTGAATTACCTTACATCTCTAGG + Intronic
1197267493 X:124390987-124391009 GTGAACTCTGCTTCATCTCCAGG + Intronic
1201782849 Y:17742511-17742533 GTGAATTCCCATACATGTCTTGG - Intergenic
1201818704 Y:18163476-18163498 GTGAATTCCCATACATGTCTTGG + Intergenic