ID: 988598303

View in Genome Browser
Species Human (GRCh38)
Location 5:32615821-32615843
Sequence CTCCTGGGGCATCTGTCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988598303_988598312 8 Left 988598303 5:32615821-32615843 CCAAATGACAGATGCCCCAGGAG No data
Right 988598312 5:32615852-32615874 ACTGGTGGGATTGAGGTGAAAGG No data
988598303_988598305 -10 Left 988598303 5:32615821-32615843 CCAAATGACAGATGCCCCAGGAG No data
Right 988598305 5:32615834-32615856 GCCCCAGGAGCTTGGAACACTGG No data
988598303_988598313 9 Left 988598303 5:32615821-32615843 CCAAATGACAGATGCCCCAGGAG No data
Right 988598313 5:32615853-32615875 CTGGTGGGATTGAGGTGAAAGGG No data
988598303_988598310 -6 Left 988598303 5:32615821-32615843 CCAAATGACAGATGCCCCAGGAG No data
Right 988598310 5:32615838-32615860 CAGGAGCTTGGAACACTGGTGGG No data
988598303_988598311 1 Left 988598303 5:32615821-32615843 CCAAATGACAGATGCCCCAGGAG No data
Right 988598311 5:32615845-32615867 TTGGAACACTGGTGGGATTGAGG No data
988598303_988598309 -7 Left 988598303 5:32615821-32615843 CCAAATGACAGATGCCCCAGGAG No data
Right 988598309 5:32615837-32615859 CCAGGAGCTTGGAACACTGGTGG No data
988598303_988598315 18 Left 988598303 5:32615821-32615843 CCAAATGACAGATGCCCCAGGAG No data
Right 988598315 5:32615862-32615884 TTGAGGTGAAAGGGATTATAGGG No data
988598303_988598314 17 Left 988598303 5:32615821-32615843 CCAAATGACAGATGCCCCAGGAG No data
Right 988598314 5:32615861-32615883 ATTGAGGTGAAAGGGATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988598303 Original CRISPR CTCCTGGGGCATCTGTCATT TGG (reversed) Intergenic
No off target data available for this crispr