ID: 988598306

View in Genome Browser
Species Human (GRCh38)
Location 5:32615835-32615857
Sequence ACCAGTGTTCCAAGCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988598306_988598315 4 Left 988598306 5:32615835-32615857 CCCCAGGAGCTTGGAACACTGGT No data
Right 988598315 5:32615862-32615884 TTGAGGTGAAAGGGATTATAGGG No data
988598306_988598314 3 Left 988598306 5:32615835-32615857 CCCCAGGAGCTTGGAACACTGGT No data
Right 988598314 5:32615861-32615883 ATTGAGGTGAAAGGGATTATAGG No data
988598306_988598316 19 Left 988598306 5:32615835-32615857 CCCCAGGAGCTTGGAACACTGGT No data
Right 988598316 5:32615877-32615899 TTATAGGGCTTGATTTCATTAGG No data
988598306_988598313 -5 Left 988598306 5:32615835-32615857 CCCCAGGAGCTTGGAACACTGGT No data
Right 988598313 5:32615853-32615875 CTGGTGGGATTGAGGTGAAAGGG No data
988598306_988598312 -6 Left 988598306 5:32615835-32615857 CCCCAGGAGCTTGGAACACTGGT No data
Right 988598312 5:32615852-32615874 ACTGGTGGGATTGAGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988598306 Original CRISPR ACCAGTGTTCCAAGCTCCTG GGG (reversed) Intergenic
No off target data available for this crispr