ID: 988598308

View in Genome Browser
Species Human (GRCh38)
Location 5:32615837-32615859
Sequence CCACCAGTGTTCCAAGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988598308_988598316 17 Left 988598308 5:32615837-32615859 CCAGGAGCTTGGAACACTGGTGG No data
Right 988598316 5:32615877-32615899 TTATAGGGCTTGATTTCATTAGG No data
988598308_988598314 1 Left 988598308 5:32615837-32615859 CCAGGAGCTTGGAACACTGGTGG No data
Right 988598314 5:32615861-32615883 ATTGAGGTGAAAGGGATTATAGG No data
988598308_988598315 2 Left 988598308 5:32615837-32615859 CCAGGAGCTTGGAACACTGGTGG No data
Right 988598315 5:32615862-32615884 TTGAGGTGAAAGGGATTATAGGG No data
988598308_988598312 -8 Left 988598308 5:32615837-32615859 CCAGGAGCTTGGAACACTGGTGG No data
Right 988598312 5:32615852-32615874 ACTGGTGGGATTGAGGTGAAAGG No data
988598308_988598313 -7 Left 988598308 5:32615837-32615859 CCAGGAGCTTGGAACACTGGTGG No data
Right 988598313 5:32615853-32615875 CTGGTGGGATTGAGGTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988598308 Original CRISPR CCACCAGTGTTCCAAGCTCC TGG (reversed) Intergenic
No off target data available for this crispr