ID: 988598309

View in Genome Browser
Species Human (GRCh38)
Location 5:32615837-32615859
Sequence CCAGGAGCTTGGAACACTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988598303_988598309 -7 Left 988598303 5:32615821-32615843 CCAAATGACAGATGCCCCAGGAG No data
Right 988598309 5:32615837-32615859 CCAGGAGCTTGGAACACTGGTGG No data
988598301_988598309 18 Left 988598301 5:32615796-32615818 CCAGGGTAGTGTGAGGGGTGAGA No data
Right 988598309 5:32615837-32615859 CCAGGAGCTTGGAACACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988598309 Original CRISPR CCAGGAGCTTGGAACACTGG TGG Intergenic
No off target data available for this crispr