ID: 988598310

View in Genome Browser
Species Human (GRCh38)
Location 5:32615838-32615860
Sequence CAGGAGCTTGGAACACTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988598301_988598310 19 Left 988598301 5:32615796-32615818 CCAGGGTAGTGTGAGGGGTGAGA No data
Right 988598310 5:32615838-32615860 CAGGAGCTTGGAACACTGGTGGG No data
988598303_988598310 -6 Left 988598303 5:32615821-32615843 CCAAATGACAGATGCCCCAGGAG No data
Right 988598310 5:32615838-32615860 CAGGAGCTTGGAACACTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988598310 Original CRISPR CAGGAGCTTGGAACACTGGT GGG Intergenic
No off target data available for this crispr