ID: 988598311

View in Genome Browser
Species Human (GRCh38)
Location 5:32615845-32615867
Sequence TTGGAACACTGGTGGGATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988598301_988598311 26 Left 988598301 5:32615796-32615818 CCAGGGTAGTGTGAGGGGTGAGA No data
Right 988598311 5:32615845-32615867 TTGGAACACTGGTGGGATTGAGG No data
988598303_988598311 1 Left 988598303 5:32615821-32615843 CCAAATGACAGATGCCCCAGGAG No data
Right 988598311 5:32615845-32615867 TTGGAACACTGGTGGGATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988598311 Original CRISPR TTGGAACACTGGTGGGATTG AGG Intergenic
No off target data available for this crispr