ID: 988598312

View in Genome Browser
Species Human (GRCh38)
Location 5:32615852-32615874
Sequence ACTGGTGGGATTGAGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988598308_988598312 -8 Left 988598308 5:32615837-32615859 CCAGGAGCTTGGAACACTGGTGG No data
Right 988598312 5:32615852-32615874 ACTGGTGGGATTGAGGTGAAAGG No data
988598303_988598312 8 Left 988598303 5:32615821-32615843 CCAAATGACAGATGCCCCAGGAG No data
Right 988598312 5:32615852-32615874 ACTGGTGGGATTGAGGTGAAAGG No data
988598306_988598312 -6 Left 988598306 5:32615835-32615857 CCCCAGGAGCTTGGAACACTGGT No data
Right 988598312 5:32615852-32615874 ACTGGTGGGATTGAGGTGAAAGG No data
988598307_988598312 -7 Left 988598307 5:32615836-32615858 CCCAGGAGCTTGGAACACTGGTG No data
Right 988598312 5:32615852-32615874 ACTGGTGGGATTGAGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988598312 Original CRISPR ACTGGTGGGATTGAGGTGAA AGG Intergenic
No off target data available for this crispr