ID: 988598314

View in Genome Browser
Species Human (GRCh38)
Location 5:32615861-32615883
Sequence ATTGAGGTGAAAGGGATTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988598303_988598314 17 Left 988598303 5:32615821-32615843 CCAAATGACAGATGCCCCAGGAG No data
Right 988598314 5:32615861-32615883 ATTGAGGTGAAAGGGATTATAGG No data
988598306_988598314 3 Left 988598306 5:32615835-32615857 CCCCAGGAGCTTGGAACACTGGT No data
Right 988598314 5:32615861-32615883 ATTGAGGTGAAAGGGATTATAGG No data
988598307_988598314 2 Left 988598307 5:32615836-32615858 CCCAGGAGCTTGGAACACTGGTG No data
Right 988598314 5:32615861-32615883 ATTGAGGTGAAAGGGATTATAGG No data
988598308_988598314 1 Left 988598308 5:32615837-32615859 CCAGGAGCTTGGAACACTGGTGG No data
Right 988598314 5:32615861-32615883 ATTGAGGTGAAAGGGATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988598314 Original CRISPR ATTGAGGTGAAAGGGATTAT AGG Intergenic
No off target data available for this crispr