ID: 988598315

View in Genome Browser
Species Human (GRCh38)
Location 5:32615862-32615884
Sequence TTGAGGTGAAAGGGATTATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988598306_988598315 4 Left 988598306 5:32615835-32615857 CCCCAGGAGCTTGGAACACTGGT No data
Right 988598315 5:32615862-32615884 TTGAGGTGAAAGGGATTATAGGG No data
988598303_988598315 18 Left 988598303 5:32615821-32615843 CCAAATGACAGATGCCCCAGGAG No data
Right 988598315 5:32615862-32615884 TTGAGGTGAAAGGGATTATAGGG No data
988598308_988598315 2 Left 988598308 5:32615837-32615859 CCAGGAGCTTGGAACACTGGTGG No data
Right 988598315 5:32615862-32615884 TTGAGGTGAAAGGGATTATAGGG No data
988598307_988598315 3 Left 988598307 5:32615836-32615858 CCCAGGAGCTTGGAACACTGGTG No data
Right 988598315 5:32615862-32615884 TTGAGGTGAAAGGGATTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988598315 Original CRISPR TTGAGGTGAAAGGGATTATA GGG Intergenic
No off target data available for this crispr