ID: 988599691

View in Genome Browser
Species Human (GRCh38)
Location 5:32628183-32628205
Sequence CAGGGAGCTAATCCATCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988599691_988599697 -4 Left 988599691 5:32628183-32628205 CCCTTTGATGGATTAGCTCCCTG No data
Right 988599697 5:32628202-32628224 CCTGCTTGGTCGGCTGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988599691 Original CRISPR CAGGGAGCTAATCCATCAAA GGG (reversed) Intergenic
No off target data available for this crispr