ID: 988599697

View in Genome Browser
Species Human (GRCh38)
Location 5:32628202-32628224
Sequence CCTGCTTGGTCGGCTGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988599691_988599697 -4 Left 988599691 5:32628183-32628205 CCCTTTGATGGATTAGCTCCCTG No data
Right 988599697 5:32628202-32628224 CCTGCTTGGTCGGCTGTGTAAGG No data
988599692_988599697 -5 Left 988599692 5:32628184-32628206 CCTTTGATGGATTAGCTCCCTGC No data
Right 988599697 5:32628202-32628224 CCTGCTTGGTCGGCTGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988599697 Original CRISPR CCTGCTTGGTCGGCTGTGTA AGG Intergenic
No off target data available for this crispr