ID: 988599967 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:32630804-32630826 |
| Sequence | TAGGGTGACCATTATGTGAT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 988599962_988599967 | 6 | Left | 988599962 | 5:32630775-32630797 | CCACTTCCACTATATCAGCATGG | No data | ||
| Right | 988599967 | 5:32630804-32630826 | TAGGGTGACCATTATGTGATAGG | No data | ||||
| 988599964_988599967 | 0 | Left | 988599964 | 5:32630781-32630803 | CCACTATATCAGCATGGTCATAA | No data | ||
| Right | 988599967 | 5:32630804-32630826 | TAGGGTGACCATTATGTGATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 988599967 | Original CRISPR | TAGGGTGACCATTATGTGAT AGG | Intergenic | ||
| No off target data available for this crispr | |||||