ID: 988599967

View in Genome Browser
Species Human (GRCh38)
Location 5:32630804-32630826
Sequence TAGGGTGACCATTATGTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988599962_988599967 6 Left 988599962 5:32630775-32630797 CCACTTCCACTATATCAGCATGG No data
Right 988599967 5:32630804-32630826 TAGGGTGACCATTATGTGATAGG No data
988599964_988599967 0 Left 988599964 5:32630781-32630803 CCACTATATCAGCATGGTCATAA No data
Right 988599967 5:32630804-32630826 TAGGGTGACCATTATGTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988599967 Original CRISPR TAGGGTGACCATTATGTGAT AGG Intergenic
No off target data available for this crispr