ID: 988602044

View in Genome Browser
Species Human (GRCh38)
Location 5:32649230-32649252
Sequence ATAATTTGGAAAAGTGTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988602039_988602044 8 Left 988602039 5:32649199-32649221 CCGACGAGAAATAGGGCCATCCT No data
Right 988602044 5:32649230-32649252 ATAATTTGGAAAAGTGTGGCCGG No data
988602040_988602044 -8 Left 988602040 5:32649215-32649237 CCATCCTAGCTGCTTATAATTTG No data
Right 988602044 5:32649230-32649252 ATAATTTGGAAAAGTGTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988602044 Original CRISPR ATAATTTGGAAAAGTGTGGC CGG Intergenic
No off target data available for this crispr