ID: 988608644

View in Genome Browser
Species Human (GRCh38)
Location 5:32704159-32704181
Sequence AGACAGAGTGCAATGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 1, 2: 6, 3: 32, 4: 238}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988608644_988608648 22 Left 988608644 5:32704159-32704181 CCCACAGTCATTGCACTCTGTCT 0: 1
1: 1
2: 6
3: 32
4: 238
Right 988608648 5:32704204-32704226 CCACACCACATGGCTGCTGCTGG 0: 2
1: 4
2: 17
3: 60
4: 333
988608644_988608650 24 Left 988608644 5:32704159-32704181 CCCACAGTCATTGCACTCTGTCT 0: 1
1: 1
2: 6
3: 32
4: 238
Right 988608650 5:32704206-32704228 ACACCACATGGCTGCTGCTGGGG No data
988608644_988608651 25 Left 988608644 5:32704159-32704181 CCCACAGTCATTGCACTCTGTCT 0: 1
1: 1
2: 6
3: 32
4: 238
Right 988608651 5:32704207-32704229 CACCACATGGCTGCTGCTGGGGG No data
988608644_988608653 29 Left 988608644 5:32704159-32704181 CCCACAGTCATTGCACTCTGTCT 0: 1
1: 1
2: 6
3: 32
4: 238
Right 988608653 5:32704211-32704233 ACATGGCTGCTGCTGGGGGATGG 0: 4
1: 8
2: 38
3: 116
4: 650
988608644_988608649 23 Left 988608644 5:32704159-32704181 CCCACAGTCATTGCACTCTGTCT 0: 1
1: 1
2: 6
3: 32
4: 238
Right 988608649 5:32704205-32704227 CACACCACATGGCTGCTGCTGGG No data
988608644_988608654 30 Left 988608644 5:32704159-32704181 CCCACAGTCATTGCACTCTGTCT 0: 1
1: 1
2: 6
3: 32
4: 238
Right 988608654 5:32704212-32704234 CATGGCTGCTGCTGGGGGATGGG 0: 5
1: 11
2: 31
3: 108
4: 512
988608644_988608646 12 Left 988608644 5:32704159-32704181 CCCACAGTCATTGCACTCTGTCT 0: 1
1: 1
2: 6
3: 32
4: 238
Right 988608646 5:32704194-32704216 GATTCTCTCTCCACACCACATGG 0: 4
1: 13
2: 38
3: 64
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988608644 Original CRISPR AGACAGAGTGCAATGACTGT GGG (reversed) Intronic
902280078 1:15367892-15367914 AGACAGAGTGCAGGGGCTGAGGG - Intronic
904229280 1:29054164-29054186 CAACACAGTGCAGTGACTGTGGG - Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908212264 1:61912915-61912937 AGACAGATTTCAAAGACTGGTGG - Intronic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909974743 1:82032259-82032281 AGCTACAGAGCAATGACTGTGGG - Intergenic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
914959558 1:152194434-152194456 AGAAAGAGTGAAATGACTTAAGG - Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915011210 1:152687797-152687819 AGAAGGAGTTCAGTGACTGTGGG - Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918540507 1:185626852-185626874 AGACAGAGTTTAATACCTGTAGG - Intergenic
919977061 1:202619546-202619568 AGACAGGGTGCAATGGCAGAGGG - Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921959651 1:221021524-221021546 AGACAGAGGGGAATGATGGTGGG + Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922420540 1:225458259-225458281 AGACAGATAGTAATGAGTGTGGG + Intergenic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
1064870319 10:19929828-19929850 GGACAGTGTGAAATGAATGTGGG - Intronic
1065644063 10:27816180-27816202 AGACAGGGTGCAGGGACAGTGGG - Intronic
1066046518 10:31600147-31600169 AGACAGAAAGCCAAGACTGTAGG + Intergenic
1066439810 10:35427736-35427758 AAACAAAGTACAATGTCTGTGGG + Intronic
1070848820 10:79546098-79546120 ACACTGACTGCAATGTCTGTGGG + Intergenic
1072917404 10:99547093-99547115 AGAGAATGTGCAATCACTGTGGG - Intergenic
1074057367 10:109934795-109934817 AGACAGAGCACAATAAATGTTGG + Intergenic
1074164605 10:110864010-110864032 AGACAGAGTCCAGTGATGGTGGG + Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1079443280 11:20536259-20536281 AGCCAGAGTGCCGTGACTGTGGG - Intergenic
1079473998 11:20808797-20808819 AGAGGGAGTACAATGATTGTGGG - Intronic
1079760146 11:24319148-24319170 AGAGAGAGTGCAAGGATTGTGGG - Intergenic
1080096879 11:28418775-28418797 AGGCAAAGTGCAGTGAATGTGGG + Intergenic
1084249074 11:67881817-67881839 AGATAGAGTGGCATGACTATCGG - Intergenic
1085716254 11:78876180-78876202 ATAGAGAGTGCATTGACTGCTGG + Intronic
1086411408 11:86548232-86548254 ATACAGAGTTCAATCACTGAGGG - Intronic
1086901849 11:92376379-92376401 AGACAGAGGGAAATAACAGTGGG + Intronic
1088134706 11:106540501-106540523 AGTCAGAGTGCACAGACTGAAGG - Intergenic
1088474872 11:110225054-110225076 AGCCAGTGTGCATTGACTGTAGG - Intronic
1089075223 11:115733300-115733322 AGAATGAGTGCTATGACTGGTGG + Intergenic
1089503584 11:118947904-118947926 AGACAGACTGCAGTGATTTTAGG - Intronic
1090961500 11:131561479-131561501 AGACAGAGTGAAAGGATAGTGGG + Intronic
1092184676 12:6470282-6470304 GGAGAGGGTGCAATGATTGTGGG + Intronic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096368540 12:51048792-51048814 GGAGAGAGCGCAATGCCTGTGGG - Intronic
1096815118 12:54197004-54197026 AGGCAGAGGGCAATGACAGACGG + Intergenic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1098915703 12:76254844-76254866 AGACAGAGTTGAGAGACTGTGGG + Intergenic
1099254986 12:80304669-80304691 AGAAAGACAGCAATGACTGAAGG - Intronic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1101696530 12:107132491-107132513 AGGCAGAGCTCACTGACTGTGGG + Intergenic
1102266514 12:111490810-111490832 AGAGAGAGAGAAATGACTGTGGG + Intronic
1104889099 12:132131480-132131502 CGACAAAGTGCAGTGATTGTCGG - Intronic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1107554949 13:41509494-41509516 AGACAAAATGCCATGACTATTGG + Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1109207137 13:59495156-59495178 AAACAGAGTGGTATTACTGTGGG + Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110612205 13:77501429-77501451 AGTCACAGGGCAATGCCTGTTGG + Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1112452699 13:99526472-99526494 AGAGACAGTGAAAAGACTGTAGG + Intronic
1113776371 13:112947935-112947957 ACACAGAGTGCAAGAGCTGTGGG - Intronic
1117795546 14:59389370-59389392 AGAAAGAGTGCAGTGGTTGTGGG - Intergenic
1118313572 14:64710049-64710071 AGACAGGTCCCAATGACTGTAGG - Intronic
1121836512 14:97097272-97097294 AGAAAGAGTGCAATGAGTATCGG - Intergenic
1122151592 14:99728845-99728867 AGGCAGAGGGCATGGACTGTGGG - Intergenic
1122581686 14:102775817-102775839 CGACAGGGTGCCAGGACTGTGGG + Intergenic
1124410583 15:29433120-29433142 ACACAGAGTGCCAGGACCGTCGG - Intronic
1124947202 15:34280016-34280038 AGACAGAGTGAAATGATTGTGGG + Intronic
1126439796 15:48675195-48675217 AGAGTGAGAGCAATAACTGTAGG - Intergenic
1128267473 15:66279373-66279395 AGACAGATTGCAATGAGTGGAGG - Intergenic
1130395879 15:83500821-83500843 AGAAAGAGTCCAAGGATTGTGGG - Intronic
1132327860 15:100986788-100986810 AGGCAGAGGGCAAGGAGTGTAGG - Intronic
1133411841 16:5575491-5575513 AGACAGACTGTGATGGCTGTGGG - Intergenic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1134411673 16:14007720-14007742 AGACAGATCGTAATAACTGTTGG - Intergenic
1138860173 16:60746153-60746175 TGACAGAGTACTATGACTGATGG + Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140800084 16:78479002-78479024 AGGCATATTGCCATGACTGTAGG + Intronic
1142492455 17:287753-287775 AGAGAGAGTGCGAGGTCTGTCGG - Intronic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1144330238 17:14216719-14216741 TGAGAGAGTCCAAAGACTGTGGG + Intergenic
1144334164 17:14254571-14254593 AGACAAAATGCACTGGCTGTTGG + Intergenic
1144661933 17:17076518-17076540 AGACACAATGCAAGGCCTGTGGG - Intronic
1146267195 17:31460546-31460568 AGACAGAGTGCTAGAAATGTTGG + Intronic
1147312111 17:39601551-39601573 AGCCAGAGTGCAGGGAATGTGGG + Intergenic
1148357806 17:46987540-46987562 GGACAGAGTGCACTGGCTCTAGG + Intronic
1149194993 17:54108887-54108909 ACACACACAGCAATGACTGTGGG + Intergenic
1149649296 17:58266930-58266952 AGAGAGAAACCAATGACTGTTGG + Intronic
1150260195 17:63783123-63783145 ATACAGAGTGCATTCACTGGTGG - Intronic
1150516393 17:65814536-65814558 TGACACAGTGCAATAAATGTTGG + Intronic
1151001958 17:70387949-70387971 AGAGAGAGTGCTGTGTCTGTTGG + Intergenic
1153403893 18:4713340-4713362 AGCCAGAGTGCATTGAATGAAGG - Intergenic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1154015232 18:10609871-10609893 AAACAGAGAGGAAGGACTGTAGG - Intergenic
1154365819 18:13708076-13708098 AGAAAGAGTTCAATAACTGTAGG - Intronic
1155250519 18:23949159-23949181 ACACAGTGTGCATTGACAGTGGG - Intronic
1158808164 18:60999944-60999966 AGAGAGAGAGCTATGACTATAGG - Intergenic
1160135124 18:76265119-76265141 AAACAGATTGTGATGACTGTCGG - Intergenic
1164113884 19:22197269-22197291 AGCTAGAGTGCAATGAATCTTGG - Intergenic
925158470 2:1664455-1664477 AGAAAGAGGGCTAGGACTGTAGG + Intronic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
925979662 2:9166641-9166663 AGACACAGAGCACTGACTCTGGG + Intergenic
928715648 2:34056696-34056718 AGGAAGAGTGCCATGATTGTGGG - Intergenic
928767855 2:34670003-34670025 AGAAAGAGTGTAGTGACTCTGGG + Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
932268796 2:70390918-70390940 AGACAGAGTTCACTGACTGTGGG + Intergenic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
937294905 2:120804267-120804289 AGACAGAGTGCAAAGACACCAGG - Intronic
938251033 2:129815941-129815963 AGAAAGAGTGTAATGATTGCAGG + Intergenic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
939427199 2:142054672-142054694 AGACAGAGTTCACTCACTGTAGG - Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943197221 2:184769175-184769197 AGAAAGTGTGCAATTACTATAGG - Intronic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944005278 2:194897097-194897119 AGAGAGAGTGCAACTATTGTGGG - Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944855209 2:203760514-203760536 AGAAAGAGTGCAGTGATTGCAGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168852790 20:988143-988165 GGCCAGAGTGCAGTGACTGAGGG + Intronic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1170900329 20:20456406-20456428 AGACAGAGAGAAATGTCCGTTGG + Intronic
1172980390 20:38937269-38937291 TGGGAGAGTGCCATGACTGTGGG + Intronic
1173471948 20:43330698-43330720 AAACAGAGTGCACTGCCTGGTGG - Intergenic
1174427357 20:50441589-50441611 AGGGAAAGTGCAAAGACTGTGGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177904282 21:26956572-26956594 AGAGATAGTGAAATGATTGTGGG - Intronic
1178080552 21:29059325-29059347 ACATAGAGTGCAAAGACTGGGGG + Intronic
1178785868 21:35652786-35652808 AGCCAGAGAGCAAGGAGTGTGGG - Intronic
1183176707 22:36229720-36229742 AGCCAGACTGCAATGTCTGAGGG - Intronic
1183181525 22:36263373-36263395 AGCCAGACTGCAATGTCTGAGGG + Intronic
1183824353 22:40373392-40373414 AGTCAGACTGCAATGAATGAAGG - Intronic
1184857362 22:47153707-47153729 TGACAGATTGCAATGGCTGGGGG + Intronic
950567996 3:13782607-13782629 GGCCAGAGTGCAGTGACTGCAGG - Intergenic
951136929 3:19114651-19114673 AGACAGACTGTTAAGACTGTTGG + Intergenic
952712515 3:36445634-36445656 AGACAGAATGCTATGTCTGAAGG - Intronic
955931829 3:64065201-64065223 AGTCAGAGTCCAAAGACAGTTGG + Intergenic
957007528 3:74967827-74967849 ATACAGACTACAATGCCTGTTGG - Intergenic
958147005 3:89639277-89639299 AGAAAGAATACAGTGACTGTGGG + Intergenic
958151544 3:89699717-89699739 AGACAGAGTGCAGCTCCTGTTGG - Intergenic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
959250998 3:103945740-103945762 AAGCAGAGTGCAATTACTTTAGG + Intergenic
959913841 3:111794297-111794319 AGAGAGGGTGCAGTGACTGCGGG - Intronic
961199453 3:125032718-125032740 AGACAGAGAGAAGTGATTGTAGG + Intronic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
963622015 3:147622319-147622341 AGAGAGAGTGGAAAGACTATTGG - Intergenic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
971393595 4:26208377-26208399 AGAGAGAGTGCAATGCCCTTGGG - Intronic
971496137 4:27267385-27267407 AGACAGATTTCAATGCCTCTTGG - Intergenic
973940912 4:55909792-55909814 ACACACAGTTTAATGACTGTAGG + Intergenic
975618930 4:76276322-76276344 AGAAAGAAGGCAAAGACTGTTGG + Intronic
977627975 4:99209276-99209298 AGACAGAGAGAAATGGTTGTAGG - Intronic
980095390 4:128484715-128484737 ACACAGAGTGCAAAGATTGGTGG + Intergenic
982911454 4:161148057-161148079 AGGAAGAGTACATTGACTGTAGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983661937 4:170137343-170137365 AGACACAGTGCCATCCCTGTTGG - Intergenic
985550648 5:531822-531844 AGGCAGAGTGGAAGGGCTGTGGG - Intergenic
985670459 5:1204021-1204043 AGAGAGAGTGCGCTGTCTGTGGG - Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
988608644 5:32704159-32704181 AGACAGAGTGCAATGACTGTGGG - Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991630350 5:68650475-68650497 AGACACAGTGCCCTGACTCTGGG - Intergenic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995829153 5:116334471-116334493 AGACATAGTGAAATGACAGTGGG - Intronic
996440646 5:123486462-123486484 AGACAGAGTGCCATAAATGGAGG + Intergenic
997739086 5:136238021-136238043 AGGCAGAGTGCAATGAGTGAAGG - Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1003494481 6:6652327-6652349 AGACACAGTTCAAAGACTTTTGG + Intronic
1004157024 6:13178773-13178795 AGACAGTGTTCACTGAGTGTTGG - Intronic
1004425334 6:15503241-15503263 AGGCAGAGTGCAATGAGTGGAGG - Intronic
1004447706 6:15715720-15715742 ACAGGGAGTTCAATGACTGTGGG + Intergenic
1005162562 6:22881167-22881189 AGAGAGAATGCCAGGACTGTAGG + Intergenic
1005346650 6:24897131-24897153 ACACAGGGAGCAATGAATGTGGG + Intronic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1007265518 6:40592730-40592752 AGTAAGAGTGCCAGGACTGTAGG + Intergenic
1008532434 6:52476054-52476076 AGACAGTGTGCAGTGAATGGAGG + Intronic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1012684022 6:102220977-102220999 AGACAAAGTGCAATAACTCCGGG - Intergenic
1012711161 6:102607154-102607176 AGACAGAGTACAATTAATATAGG + Intergenic
1013746411 6:113351639-113351661 CTGCAGAGTGCAATGACTTTGGG - Intergenic
1013858307 6:114602484-114602506 AGACTGAGTGCAATGGCAGGTGG + Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1019066301 6:169302206-169302228 AGAGAGAGTCAAATGAATGTGGG + Intergenic
1019087001 6:169487947-169487969 AGAGAGAGTGCTGTGTCTGTGGG - Intronic
1019679461 7:2337627-2337649 AGACAGAGAGCAATGCCTGGAGG + Intronic
1023267626 7:38424195-38424217 AGATAGAGTTCATTGACTGTGGG - Intronic
1024038598 7:45531300-45531322 GGGCACAGAGCAATGACTGTAGG + Intergenic
1024586855 7:50849583-50849605 AGATAGAGGGGAATCACTGTTGG - Intergenic
1024781776 7:52859204-52859226 ACACTGAGTGCAATGAATGGAGG - Intergenic
1024782756 7:52870897-52870919 ATACAGAGTGATATGACTTTGGG + Intergenic
1026194280 7:68159253-68159275 AGACAAAGTGCATTTTCTGTGGG - Intergenic
1026356411 7:69561483-69561505 ACACAGAGCCCAATCACTGTTGG - Intergenic
1027461586 7:78460898-78460920 AGACAGGGTGCCATCACTATTGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027539377 7:79449453-79449475 AGCCATAGTGCAAGGAATGTAGG + Intronic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029899962 7:104028809-104028831 AGACATAGTGTTATGAATGTTGG + Intergenic
1030204042 7:106935190-106935212 AAACAGAGAACAATGAGTGTTGG + Intergenic
1030288896 7:107853024-107853046 AAACACAGTGCAATGATTTTGGG - Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1031972173 7:128072926-128072948 CGACAGAGTCCAGTGTCTGTGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1033928272 7:146490426-146490448 ACACAAAGTGTAAAGACTGTGGG + Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035417239 7:158699966-158699988 CTGCAGAGTGCAGTGACTGTTGG + Intronic
1035818812 8:2569462-2569484 AGACAGAGAGCAAAGGCTGCGGG + Intergenic
1036757954 8:11483918-11483940 AGTAAGAGTGCAATCAGTGTTGG + Intergenic
1037461579 8:19115803-19115825 AGAAGGAGTGTAATTACTGTGGG - Intergenic
1039434919 8:37553447-37553469 AGACAGTGTGCAGTGTCTGCTGG - Intergenic
1041415890 8:57608739-57608761 AGACAGAGTGCAATGACTGGGGG + Intergenic
1041754410 8:61298108-61298130 AGATAGATTGCAATGAGTGTAGG + Intronic
1042642509 8:70951784-70951806 AGACAGCTTGCACTGACAGTTGG - Intergenic
1042711024 8:71717579-71717601 AGACAAACTGCATTGACTGAAGG - Intergenic
1043042958 8:75284823-75284845 AGGCAGAGTGAAATTACTGGGGG - Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043819704 8:84847288-84847310 AGGCTGAGTGAAGTGACTGTGGG - Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1048893803 8:138970792-138970814 AGACAGAGTTCAATGATTTCAGG + Intergenic
1049021408 8:139959934-139959956 ACACAGAGAGCAAGGGCTGTGGG + Intronic
1049280908 8:141743708-141743730 TGACAGAGGGCACTGACTGAGGG + Intergenic
1049900685 9:160907-160929 AGAAAAATTCCAATGACTGTTGG - Intronic
1050426536 9:5517377-5517399 AGACAGACTGCAATGGATGGCGG + Intronic
1050688290 9:8196935-8196957 AGACACAGTGCAATGGAAGTGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1051483957 9:17588268-17588290 AGACAGAATGCTACGATTGTTGG + Intronic
1053307231 9:36993650-36993672 AGCCAGAGAGAAAGGACTGTGGG + Intronic
1053743724 9:41171190-41171212 AGAAAAATTCCAATGACTGTTGG - Intronic
1054349000 9:64001007-64001029 AGAAAAATTCCAATGACTGTTGG - Intergenic
1054483547 9:65694116-65694138 AGAAAAATTCCAATGACTGTTGG + Intronic
1054684619 9:68260068-68260090 AGAAAAATTCCAATGACTGTTGG + Intronic
1056515676 9:87346985-87347007 AGGCACAGTGCAATGAAAGTGGG - Intergenic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057358101 9:94348581-94348603 AGAAAGAGTTGAATAACTGTAGG + Intergenic
1057649648 9:96909036-96909058 AGAAAGAGTTGAATAACTGTAGG - Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058445797 9:105053802-105053824 AGAAAGAGTTCAATGATTGCAGG - Intergenic
1059431279 9:114251867-114251889 AGACACAGTGCAGTGAGGGTGGG - Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1187571929 X:20513223-20513245 AGTCAAAGTGTAATGCCTGTTGG + Intergenic
1187693909 X:21899175-21899197 AGAGAGAGAGAAATGACTTTTGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188227801 X:27623070-27623092 AGATAGACTTCAATGACTGGTGG + Intronic
1188549805 X:31350702-31350724 ACACTGAGTGCACTGACTGCAGG + Intronic
1188609004 X:32072475-32072497 AGAAAGAACACAATGACTGTGGG - Intronic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192882651 X:75303283-75303305 AGACAGAGAGCAATGATCTTTGG - Intronic
1193514337 X:82445569-82445591 AGATAGATTGCAAAAACTGTGGG - Intergenic
1193850986 X:86537094-86537116 ACACAGAATGCAAGGAATGTGGG - Intronic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195390568 X:104357984-104358006 AGAAAGAGTATAATGACTGCAGG + Intergenic
1195419176 X:104654422-104654444 AGACAAAGTGCAAACACCGTGGG + Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1198999215 X:142613604-142613626 AGACAGAGTGCACAAATTGTTGG + Intergenic
1199174461 X:144769110-144769132 ACACAGACTGCAATCCCTGTAGG - Intergenic
1199431839 X:147770667-147770689 AGAGAGAGTTCAGTGGCTGTGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200477820 Y:3662699-3662721 AGACAGATATCAATGACTTTTGG - Intergenic