ID: 988609361

View in Genome Browser
Species Human (GRCh38)
Location 5:32710775-32710797
Sequence ACGAGAAAGGTGAGAGCAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 294}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988609355_988609361 12 Left 988609355 5:32710740-32710762 CCCGCGTCGGTGCTTCAGGAGGG 0: 1
1: 0
2: 1
3: 5
4: 65
Right 988609361 5:32710775-32710797 ACGAGAAAGGTGAGAGCAAGCGG 0: 1
1: 0
2: 2
3: 25
4: 294
988609357_988609361 11 Left 988609357 5:32710741-32710763 CCGCGTCGGTGCTTCAGGAGGGA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 988609361 5:32710775-32710797 ACGAGAAAGGTGAGAGCAAGCGG 0: 1
1: 0
2: 2
3: 25
4: 294
988609353_988609361 13 Left 988609353 5:32710739-32710761 CCCCGCGTCGGTGCTTCAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 988609361 5:32710775-32710797 ACGAGAAAGGTGAGAGCAAGCGG 0: 1
1: 0
2: 2
3: 25
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988609361 Original CRISPR ACGAGAAAGGTGAGAGCAAG CGG Intronic
900183435 1:1322454-1322476 AAGAGCAAGGTGAGAGAATGAGG + Intronic
900523451 1:3117059-3117081 ACGGGAAGGGCTAGAGCAAGGGG + Intronic
900658271 1:3770804-3770826 AGGAGGAAGGGGAGAGAAAGAGG + Intronic
900720176 1:4170875-4170897 AGGAGAAGGGTGAGAAGAAGAGG - Intergenic
900772824 1:4559314-4559336 ACGAGACATCTGAGAGGAAGGGG + Intergenic
902727660 1:18347827-18347849 ATGAGAAACGAAAGAGCAAGTGG - Intronic
902859659 1:19235993-19236015 AGGAGAAATGGCAGAGCAAGGGG + Intronic
903656592 1:24952678-24952700 ACAAGGAAGGTGAGAACAGGAGG - Intronic
906273974 1:44502397-44502419 AGGAGAAAGATCAGAGGAAGAGG + Intronic
907796436 1:57722750-57722772 AGGAGAAAGGGGAGAACAATGGG + Intronic
907969001 1:59362270-59362292 AAGAGAAAGGACAGAGCAAATGG - Intronic
910012123 1:82478239-82478261 AGGAGAAAGGAAAGAGCAGGTGG + Intergenic
910292428 1:85612444-85612466 ACAAGAAAGGTGAAAGCCAGGGG - Intergenic
910308627 1:85797394-85797416 ACTAGAAAGGTGAGTGAAGGAGG + Intronic
911858570 1:102914781-102914803 AGGAGAAAGAGGAGAGAAAGGGG - Exonic
912221206 1:107677960-107677982 CCAAGAAAGATGCGAGCAAGAGG + Intronic
912389791 1:109295097-109295119 ATGTGAAAGGTAAGGGCAAGAGG - Exonic
912531456 1:110326687-110326709 ACGGGAAAGTTGATAACAAGTGG - Intergenic
914696804 1:150090342-150090364 AAGAGGAAGGGGAGAGAAAGGGG - Intronic
915044681 1:153002233-153002255 ACGAGGAAGGTGAGAGCATCAGG + Intronic
915234329 1:154469519-154469541 AGGAGAAAGGAGTGAGGAAGGGG + Intergenic
917484395 1:175442357-175442379 AGGAGCAAGATGAAAGCAAGTGG + Intronic
919629057 1:199942175-199942197 AAGAGAAATGTGCCAGCAAGAGG + Intergenic
921342896 1:214152492-214152514 ATGAGAAAGCTGAGACCCAGAGG - Intergenic
921442397 1:215203016-215203038 AGGAGAAAGGAGAGAGGAAGAGG - Intronic
924171968 1:241351729-241351751 AGGAGAAAGGTGAGGGGAAGGGG + Intronic
924786969 1:247207893-247207915 AGTAGAAAGGTGAGAGTGAGAGG - Intergenic
1063620172 10:7639874-7639896 ATGAGAAAGGAGAGAGACAGTGG + Intronic
1065298676 10:24301192-24301214 AAGAGAAATGTGAGAGCAGGGGG - Intronic
1067242175 10:44506397-44506419 AGAAAAAAGGTGGGAGCAAGCGG - Intergenic
1067479706 10:46586963-46586985 ACGAGGAAGGTCAGAGCACCAGG - Intronic
1067545309 10:47188444-47188466 AAGAGAAAGAAGAGAGGAAGAGG + Intergenic
1067615031 10:47754834-47754856 ACGAGGAAGGTCAGAGCACCAGG + Intergenic
1070574987 10:77670948-77670970 AAGAGAGAGGAGAGAGCAATAGG + Intergenic
1071630435 10:87214800-87214822 ACGAGGAAGGTCAGAGCACCAGG + Intergenic
1071708787 10:88028278-88028300 AAGACAAAGGAGAGAGGAAGTGG + Intergenic
1072247125 10:93553755-93553777 AGGAGAAAGGGGAGATGAAGTGG + Intergenic
1072751907 10:97986860-97986882 AAGAGAAAAGTGAGAACAGGAGG - Intronic
1074274915 10:111991926-111991948 ACCAAAGAGGTGAGAGCAAAAGG + Intergenic
1075364323 10:121870641-121870663 AAGAGAAAGGTGAGAGAGAAGGG - Intronic
1076318612 10:129562307-129562329 ACGAACAAGGTGCCAGCAAGGGG - Intronic
1077258167 11:1598618-1598640 ACAGGAAAGATGAGAGCACGTGG - Intergenic
1078578280 11:12519234-12519256 ACCAGAAAAGTGCGAGCAAAAGG - Intronic
1080780329 11:35423416-35423438 AGGAGAAAACTGAGACCAAGAGG + Intergenic
1081552064 11:44122730-44122752 ACAAGGTAGGTGAGAGCCAGAGG - Intronic
1083997567 11:66279660-66279682 AAGAGAAAGGAGAGAGGAAGTGG - Intronic
1084471598 11:69363431-69363453 ACTAGAATGGTGAGTGCTAGGGG + Intronic
1084656995 11:70525512-70525534 AAGAGAGAGGTGAGAGAAAAGGG + Intronic
1084798692 11:71526910-71526932 ACAGGAAAGATGAGAGCACGTGG + Intergenic
1084803792 11:71565198-71565220 ACAGGAAAGATGAGAGCATGTGG + Intronic
1084838103 11:71820555-71820577 AAGAGAAAGTTGAGAACAGGAGG - Intergenic
1086072246 11:82812211-82812233 ACTTGAAAGGTGAGTGAAAGTGG - Intergenic
1086089846 11:82994305-82994327 AAGAGAAAGGAGGGAGAAAGTGG + Intronic
1086589344 11:88493808-88493830 AGGAGAAAGGCTACAGCAAGAGG + Intergenic
1086863069 11:91947904-91947926 ACTGGAAAGGAGAGAGTAAGGGG - Intergenic
1087952519 11:104240372-104240394 AAGAGAAAGGAGAGAGAGAGAGG - Intergenic
1088355731 11:108942078-108942100 AGGAGAAATGTGAGAGCAGAGGG - Intergenic
1089018057 11:115183151-115183173 ACAAGAAAGGTGACTGCTAGTGG + Intronic
1089664677 11:120010697-120010719 AAGAGAAAGTGGAGAGCAAGAGG - Intergenic
1090527320 11:127551450-127551472 AAGAGAAAGGAGAGCACAAGAGG - Intergenic
1091409293 12:228692-228714 GCGTGAAAGGAGGGAGCAAGGGG - Intronic
1093017641 12:14170950-14170972 AGGAGAAGGGTGAGGGGAAGGGG + Intergenic
1093441570 12:19203521-19203543 ACTAGACAGGAGAGAGAAAGAGG - Intronic
1093753186 12:22824697-22824719 ACTAGAAGGGAGAGAGAAAGAGG - Intergenic
1094491797 12:30965357-30965379 AGGAGGCAGGTGAGAGCACGTGG - Intronic
1096254850 12:50056729-50056751 AGGAGAAAGGTGAGAGCCACAGG + Intergenic
1097070983 12:56354764-56354786 AGGAGAAAGGTGGGAGACAGAGG - Exonic
1098189207 12:67930164-67930186 ACTTGAATGGTGACAGCAAGAGG + Intergenic
1098845604 12:75531368-75531390 ACTAGAAAGGGGAGGGCAAAAGG + Intergenic
1099176035 12:79423284-79423306 ACTAGAAAGGAGGGAGCTAGTGG + Intronic
1099207505 12:79744982-79745004 AAAGGAAAGGAGAGAGCAAGGGG + Intergenic
1101782180 12:107845949-107845971 ACGAGAATGGTGAGTGAAAGGGG - Intergenic
1103806217 12:123575221-123575243 AAGAGAAAGGGGAGGGGAAGTGG - Intergenic
1104870064 12:131988654-131988676 ACTAGAAAAGTGAGAACAAGTGG + Intronic
1107152393 13:37127347-37127369 AAGAGAAAGGTCAGGTCAAGAGG - Intergenic
1107560536 13:41553391-41553413 ATGTGAAATGTGAGAGAAAGAGG - Intergenic
1107886654 13:44879260-44879282 AAGAGGCAGGTGAGGGCAAGAGG + Intergenic
1108276801 13:48819133-48819155 ACGAGAATGGTGATATCAAAAGG - Intergenic
1110386958 13:74923704-74923726 AGGAGAAAGGAGAAAGAAAGAGG + Intergenic
1112714035 13:102163457-102163479 TCGAGGAAGTTTAGAGCAAGTGG + Intronic
1114004977 14:18302493-18302515 CCAAGCAAGATGAGAGCAAGTGG - Intergenic
1114260103 14:21030425-21030447 GGGAGAAAGGAGAGAGCAACAGG + Intronic
1116407970 14:44588730-44588752 AAGAGAATGGGGAGAGAAAGAGG + Intergenic
1116683982 14:48014261-48014283 AGGAGAAAGAAGAGAGAAAGAGG + Intergenic
1117108944 14:52428512-52428534 AAGAGAAAGGTCTGAGGAAGTGG + Intergenic
1117464800 14:55982497-55982519 AGGAGAGAGGTGGGAGTAAGAGG + Intergenic
1117491512 14:56252595-56252617 AGTGGAAAGGTGAGAGGAAGAGG + Intronic
1118317879 14:64736883-64736905 ACGAGAAAGGTGAGTGTGTGAGG + Exonic
1118968893 14:70614606-70614628 ACAAGAAAGGAGAAAGGAAGAGG + Intergenic
1120674824 14:87408660-87408682 AAGAGAAGGGTGAGGGTAAGTGG - Intergenic
1121305823 14:92906454-92906476 ACAAGCAAGGGGAGGGCAAGTGG + Intergenic
1121933403 14:97994150-97994172 AGGTGAAAGGTGAGAGAGAGAGG + Intergenic
1123389433 15:19854727-19854749 CCAAGCAAGATGAGAGCAAGTGG - Intergenic
1124103097 15:26713494-26713516 AGGAGTAAGGAGAGAGGAAGAGG + Intronic
1126390460 15:48144182-48144204 AGGAGAAAGGTAAAAGCAAGAGG + Intronic
1128523685 15:68392518-68392540 ACCAGAAAGGAGAGAACAACAGG + Intronic
1129554321 15:76489425-76489447 ACTAGAAAGAAGACAGCAAGGGG - Intronic
1130187185 15:81695497-81695519 ACAGGAAAGGTGAGAGTAAAAGG + Intergenic
1133718276 16:8470138-8470160 ATGGGAAAAGTGAGAGCAGGGGG - Intergenic
1134260215 16:12645142-12645164 ACAAGAATGGTGAGAGGAAGGGG - Intergenic
1134339897 16:13335242-13335264 ATTAGTTAGGTGAGAGCAAGTGG + Intergenic
1134523574 16:14928974-14928996 AAGAGAAAGGGGAGAAGAAGAGG - Intronic
1134711168 16:16327459-16327481 AAGAGAAAGGGGAGAAGAAGAGG - Intergenic
1134948406 16:18341124-18341146 AAGAGAAAGGGGAGAAGAAGAGG + Intergenic
1134955661 16:18381234-18381256 AAGAGAAAGGGGAGAAGAAGAGG + Intergenic
1135068159 16:19329117-19329139 ACAAGAAAAGAGAGAGAAAGGGG - Intergenic
1136425256 16:30165821-30165843 TAGAGAAAGATGAGAACAAGGGG + Intergenic
1137360058 16:47806058-47806080 CCGAGACAGGTGAGAGCAAGAGG + Intergenic
1138073366 16:54016111-54016133 ATGAGAAAACTGAGACCAAGAGG + Intronic
1139313853 16:66050852-66050874 AAGAGACAGGTGAGACCATGAGG + Intergenic
1142715986 17:1747205-1747227 TGGAGGAGGGTGAGAGCAAGGGG + Intronic
1143410767 17:6707074-6707096 ATGAGAGAGGTGACAGCCAGAGG + Exonic
1144018312 17:11218397-11218419 CCGAGAAAGCGAAGAGCAAGAGG + Intergenic
1144266086 17:13571112-13571134 GGGAGAAAGGTGGGAGGAAGGGG + Intronic
1144845576 17:18217067-18217089 AAGAGAGAGGAGAGAGAAAGAGG + Intergenic
1146720406 17:35119737-35119759 AGGAGAAAGGAGAGAGGAGGAGG + Exonic
1148792969 17:50183931-50183953 ATAAGAAGGGTGAGAGAAAGGGG + Exonic
1149020232 17:51955138-51955160 AAGAGAAAGAAGAAAGCAAGAGG + Intronic
1149080194 17:52646863-52646885 GGGACAAAGGTGAGAGAAAGGGG + Intergenic
1151719719 17:75848113-75848135 ACGGGAGAGGTCAGAGCCAGGGG + Intronic
1152061326 17:78077893-78077915 ATGAGAAAAGTGAGATGAAGTGG - Intronic
1155170725 18:23265213-23265235 ACCAGAAATGAGAGAGCAGGAGG + Intronic
1155596880 18:27498361-27498383 AGGAGAATGGTTAGAGGAAGTGG + Intergenic
1156144331 18:34158196-34158218 AAAAGAAATTTGAGAGCAAGGGG + Intronic
1156364778 18:36415421-36415443 AAGAGAAAGGGGAGAAAAAGTGG + Intronic
1157114329 18:44849011-44849033 ATGAGAATGGGGAGAGCAGGTGG - Intronic
1157323166 18:46649485-46649507 ACGAGGAGGCTGAGGGCAAGAGG + Intronic
1158129371 18:54135946-54135968 ATGAGAAAGGTGAGAAAATGTGG - Intergenic
1158218107 18:55121644-55121666 AAGAGACAGCTGAGAGGAAGAGG - Intergenic
1158249651 18:55473335-55473357 AAGAAAAAGGAGAAAGCAAGAGG - Intronic
1159197341 18:65134552-65134574 AAGAGAATGAAGAGAGCAAGTGG - Intergenic
1159870622 18:73756799-73756821 CCCAGAAAGGTGAGTGCGAGGGG + Intergenic
1159982795 18:74806419-74806441 AGGAGGAAGGCGAGAGCCAGGGG + Intronic
1160308649 18:77767300-77767322 GATAGAAAAGTGAGAGCAAGGGG + Intergenic
1161464905 19:4423762-4423784 ATGAGAAAGAGGAGAGGAAGAGG - Intronic
1164146615 19:22516643-22516665 ACCAGAGAGGAGAGAGGAAGTGG - Intronic
1164159758 19:22618488-22618510 ACCAGAGAGGAGAGAGAAAGCGG + Intergenic
1164571656 19:29379169-29379191 AGGAAAAATGTGACAGCAAGAGG + Intergenic
1167200162 19:48059605-48059627 AGGAGAAAGATGAAAGCCAGAGG - Intronic
1168471753 19:56645828-56645850 ATGAGAAAGGTGAGAGGCAGGGG + Exonic
925380969 2:3426010-3426032 ATGATAAAGGAGAGAGCATGGGG - Intronic
926571484 2:14534697-14534719 AAGAGAAAGGTGAAAACAAAGGG - Intergenic
926751098 2:16199127-16199149 ACGAGGAAGGTGTGAGCGGGTGG - Intergenic
928161269 2:28927660-28927682 CCGAGCAAGTAGAGAGCAAGAGG + Exonic
929596270 2:43178363-43178385 ACTAGATAAGTGAGAGGAAGGGG + Intergenic
931245884 2:60492516-60492538 GTGAGGAAGGAGAGAGCAAGGGG - Intronic
931443099 2:62305119-62305141 ACAAGAAAGGTGGGAGCAGTGGG + Intergenic
931503371 2:62896292-62896314 ACTGGAAAGGAGTGAGCAAGGGG + Intronic
931639597 2:64370107-64370129 ATGGGAAAGGTGAGAACATGCGG - Intergenic
931849191 2:66235903-66235925 ACGTGAAAAGTGAGGGGAAGAGG + Intergenic
932444110 2:71762906-71762928 TCAAGAAAGGAGAGAGAAAGAGG - Intergenic
932971061 2:76542703-76542725 ACTAGAAAAGGGAGAGAAAGGGG + Intergenic
933392137 2:81684384-81684406 AGAAGAAAGGTAAAAGCAAGTGG - Intergenic
934576655 2:95405988-95406010 AGGAGAAAACTGAGAGCTAGGGG + Intronic
934638877 2:96014156-96014178 AGGAGAAAACTGAGAGCTAGGGG + Intergenic
935764866 2:106356739-106356761 ATGGGAAAGGTGAGGGCAAGTGG - Intergenic
935874810 2:107494827-107494849 ATGAGGAAGGAGAGAGGAAGAGG + Intergenic
935926027 2:108069673-108069695 ACGAGGAAGGTGAGACTGAGAGG + Intergenic
936005378 2:108882621-108882643 ACAAAAAAGGTGAGAGAAAAGGG - Intronic
938531547 2:132192606-132192628 CCAAGCAAGATGAGAGCAAGTGG + Intronic
940094036 2:149953261-149953283 AAGAGCAAGGAGAGAGCAAGAGG + Intergenic
940204199 2:151184561-151184583 ACGAGAAAGGGGAGAGAACAAGG + Intergenic
941594606 2:167460201-167460223 CCCAGAAAAGTGAGAGGAAGGGG - Intergenic
942570154 2:177305708-177305730 AAGAGAAAAGGGAGAGAAAGAGG - Intronic
942659178 2:178246092-178246114 TGGAGATAGGTGAGAGCAGGTGG - Intronic
943133326 2:183884033-183884055 AAGAGAAATGTAAGAGCAATAGG - Intergenic
946231080 2:218291719-218291741 ACGGGAAAAGGGAAAGCAAGTGG - Intronic
946439682 2:219684886-219684908 AAGAGAAAGGAGAGCACAAGGGG - Intergenic
946607659 2:221423372-221423394 AAGAGAAATGTGAGAACAATAGG - Intronic
946779467 2:223178151-223178173 ATTAGAAGGGTGAGTGCAAGAGG + Intronic
947021689 2:225684468-225684490 AAGAGAAAGGTGAGAGCTGGGGG - Intergenic
947187972 2:227472128-227472150 ACGAGGAAGGGGACGGCAAGAGG - Intergenic
948272545 2:236685765-236685787 ACCAGAAAGGTTAGACAAAGAGG - Intergenic
948345813 2:237297175-237297197 AGGAGACAGATGAGAACAAGAGG - Intergenic
1169341264 20:4798150-4798172 AGGTGAGAGGTGAGAGAAAGAGG - Intronic
1170392812 20:15893847-15893869 AGGATAAAGGTGAGAGAAATGGG + Intronic
1171382960 20:24746964-24746986 ACTAGAAAGATGAGAGAAAGAGG - Intergenic
1172538813 20:35695358-35695380 AAGACAAAGATGAGAGCAAGTGG + Intronic
1176764913 21:13006824-13006846 CCAAGCAAGATGAGAGCAAGTGG - Intergenic
1177828395 21:26109114-26109136 AAGAGGAAGGTGACAGCAAAGGG + Intronic
1178575011 21:33779004-33779026 AGGAGAAAGGAGAGAAGAAGGGG - Intronic
1178764993 21:35442109-35442131 AAGAGAAAGCTCAAAGCAAGTGG + Intronic
1179264353 21:39789521-39789543 TCGTGAAAGGGGAAAGCAAGTGG - Intronic
1180429489 22:15233283-15233305 CCAAGCAAGATGAGAGCAAGTGG - Intergenic
1183003600 22:34881563-34881585 ACGAGAAAGGCAGGGGCAAGTGG - Intergenic
1183057193 22:35314293-35314315 ACGAGAAAGGGGAGAGGAAGAGG - Intronic
1183764845 22:39863298-39863320 ACAAGAAAAGGGAGAGCAATTGG + Intronic
1184702566 22:46186311-46186333 ACCAGAAAGGGCAGAGAAAGAGG - Intronic
1184832850 22:47000714-47000736 AAGAAAAAGGTGAGAGTAGGAGG + Intronic
949840578 3:8315593-8315615 AAGAGAAAGGCAAGAGGAAGGGG + Intergenic
949933674 3:9100241-9100263 TGGAGAAAGGTAAGAGCCAGTGG - Intronic
950396378 3:12737237-12737259 AGGAGGAAGGGGAGGGCAAGAGG - Intronic
951083758 3:18485647-18485669 CAGAAAAAGGTGAGAGAAAGTGG + Intergenic
951099964 3:18676088-18676110 AGAAGAAAGGTTAGATCAAGAGG - Intergenic
951208331 3:19947291-19947313 AGGAGAAAGGAAAGAGGAAGGGG + Exonic
951990726 3:28673588-28673610 ATGAGAAAGTTGAGAGAAATAGG + Intergenic
952417229 3:33100447-33100469 ATGAGAAAGCTGAGACCCAGAGG + Intergenic
953336416 3:42098122-42098144 AGAAGAAAGGAGACAGCAAGGGG - Intronic
953863705 3:46565924-46565946 GCGAGAAAGGAGAGAGCGTGGGG - Intronic
954575339 3:51672626-51672648 ACCAGAGAGGAGAGAGAAAGTGG + Intronic
955198014 3:56823463-56823485 AGGAGAAAAGTGAGAACAGGAGG - Intronic
956240977 3:67130264-67130286 AGGAGCAAGGTGAGAGTAACAGG + Intergenic
958502835 3:94936631-94936653 ACATGCAAGGTGAGGGCAAGGGG + Intergenic
958647522 3:96891408-96891430 ACGATAAAGGTGACTGGAAGGGG + Intronic
959730525 3:109596236-109596258 CAGAGAAAGGTGAGAGTGAGGGG + Intergenic
961463835 3:127069730-127069752 ACCAGGAAGGAGAGAGGAAGGGG + Intergenic
963577981 3:147086574-147086596 AAGTGAAAGGTGAAAGGAAGGGG - Intergenic
964174152 3:153805202-153805224 ACTAGAAAGAGGTGAGCAAGGGG - Intergenic
965509015 3:169547765-169547787 AAGAGAAAGGGGAGGGCAACTGG + Intronic
966091893 3:176148243-176148265 AGGAGAAAGATGAGAGCAAAGGG + Intergenic
968537287 4:1141879-1141901 AAGAGAAAGGTGAGAGAGAATGG - Intergenic
969953102 4:10859902-10859924 ACTAGAAAGTTGATAGAAAGAGG - Intergenic
970709648 4:18846973-18846995 AAGAGAAGGGTGAGAGTAAAAGG - Intergenic
974103278 4:57440568-57440590 AGGAGGAAGGAGAGAGAAAGAGG - Intergenic
974429794 4:61780860-61780882 AAGAGAAAAGTAAGAGCAACAGG - Intronic
975264545 4:72346846-72346868 AGGAGAAAAGTGAGATGAAGAGG - Intronic
977293937 4:95191818-95191840 AGGAGAAAGGTGAGCAGAAGAGG - Intronic
979720308 4:123891999-123892021 AAGGGTAAGATGAGAGCAAGAGG - Intergenic
982371956 4:154643209-154643231 GAGAGACAGGTGGGAGCAAGAGG + Intronic
984476331 4:180239425-180239447 ACCAGAAAGGTGAGTGAAATAGG - Intergenic
984533052 4:180941197-180941219 ACGAGAAAGCTGAGACCCTGAGG - Intergenic
985361198 4:189177857-189177879 AAGAGAAACGTGGGAGCCAGAGG - Intergenic
985630475 5:1011426-1011448 AAGAAGAAGGTGAGAGCCAGAGG - Intronic
986570157 5:9156110-9156132 ACGAGAGAGGGAAGAGAAAGGGG + Intronic
986629070 5:9751845-9751867 ACAATAAAGCTGAGAGCAGGTGG - Intergenic
988609361 5:32710775-32710797 ACGAGAAAGGTGAGAGCAAGCGG + Intronic
989263381 5:39444206-39444228 GTGAGAAAGTTGAGATCAAGGGG + Intronic
989404173 5:41042063-41042085 AAGAGGAAATTGAGAGCAAGGGG + Intronic
991480123 5:67068989-67069011 ACGAGAAGGGTGTCAGCAGGAGG - Intronic
993333238 5:86625359-86625381 ACCAGAAAGGGAAGAGAAAGTGG + Intergenic
995154810 5:108898495-108898517 AGGAGAAAGGAGAGAGAAAGAGG - Intronic
995919525 5:117294998-117295020 GCAAGAAAGCTGAGAGCCAGAGG + Intergenic
998231695 5:140364991-140365013 TCGAGAGAGGGGAGAGAAAGGGG + Intronic
999117554 5:149177010-149177032 ATGAGAAAGCTGAGACCCAGAGG - Intronic
999466839 5:151815269-151815291 AAGAGACAGGTGAGGCCAAGTGG + Intergenic
1000425781 5:161089664-161089686 ACTAGAAAGGGGAGAGAAGGGGG + Intergenic
1000732416 5:164852642-164852664 AAGAGAAAGATGAGAGAGAGAGG + Intergenic
1001225538 5:169941532-169941554 GCTAGAAAGGAGAGTGCAAGAGG + Intronic
1001330904 5:170761726-170761748 ATGAGAAAGGGGAGAGGGAGAGG - Intergenic
1001381809 5:171310549-171310571 GCGAGAAGGGTGAAAGGAAGAGG - Intronic
1001962610 5:175888976-175888998 ACAAGACAGGTGAGAGCCAAGGG + Intergenic
1001964124 5:175898390-175898412 AGCAGAAAGGTGAGTGCCAGGGG - Intergenic
1002820119 6:717095-717117 CTGAGAAAGCAGAGAGCAAGGGG + Intergenic
1003928005 6:10895471-10895493 AAGAGAAAGTGGAGAGGAAGGGG + Intronic
1004021924 6:11783681-11783703 ACGAGGATGGAGAGAGCCAGTGG - Intronic
1004816604 6:19317925-19317947 AAGAGAAGAGTGAGAGCAAGAGG - Intergenic
1005003340 6:21264306-21264328 ACGAGAAAAAAGAGACCAAGAGG + Intergenic
1007107684 6:39294887-39294909 AGGAGAAGGTTGAGACCAAGAGG + Intergenic
1008321196 6:50116254-50116276 ATGAGAAAACTGAGGGCAAGTGG + Intergenic
1012290265 6:97447060-97447082 AGGAAAAAGGTAAGAGCCAGTGG - Intergenic
1013177459 6:107689859-107689881 ACGGGGAAGGTGAGTGCATGAGG - Intergenic
1015890861 6:137968445-137968467 ACGAGAGAGGGGAGATCAGGAGG - Intergenic
1016430068 6:143974046-143974068 AGGAGAGAGGAGAGAGCAAGAGG + Intronic
1017276439 6:152574486-152574508 ATGAAAGAAGTGAGAGCAAGAGG - Intronic
1018402749 6:163441870-163441892 GCAAAAAAGGTGAGGGCAAGGGG + Intronic
1019907701 7:4077211-4077233 AAGAGAAAGGTGACAGCAGGAGG - Intronic
1019954273 7:4400964-4400986 AAGAGCAAGGTGAGAGAAAGTGG + Intergenic
1021519403 7:21524226-21524248 AAGAGAAAGCTCAGAGAAAGTGG - Intergenic
1022143588 7:27514738-27514760 TGGGGAAAGGTGACAGCAAGAGG + Intergenic
1022210096 7:28200093-28200115 ACTTGAAAGGTGAGAGAAAAAGG - Intergenic
1022475637 7:30707758-30707780 AGGACAAAGGAGAGAGCCAGAGG + Intronic
1023101339 7:36721550-36721572 GCAAGAAAGGTGGGTGCAAGAGG - Intronic
1024615732 7:51109925-51109947 ATGACACAGGCGAGAGCAAGGGG + Intronic
1024711125 7:52015871-52015893 GACAGAAAGGTGATAGCAAGAGG - Intergenic
1024980708 7:55155513-55155535 ACTTTAAAGGTGAGAGCAGGTGG + Intronic
1026182928 7:68058072-68058094 ACAGGAAAGGTGAGATAAAGAGG - Intergenic
1027123144 7:75536671-75536693 ATGAGAAAGGACAGAGCCAGCGG - Exonic
1028465880 7:91151157-91151179 ATGAGAAGGGTAAGAGCAAGAGG - Intronic
1028484468 7:91342820-91342842 ATGAGAAATGGGAAAGCAAGGGG - Intergenic
1031062425 7:117066904-117066926 CAGAGAATGGTGAGAGGAAGTGG - Intronic
1033245547 7:139714074-139714096 ACGAGGGAGTGGAGAGCAAGTGG + Intronic
1035280437 7:157775218-157775240 ACCCGAAGGGTGAGAGCGAGTGG - Intronic
1035672555 8:1431499-1431521 AAGAGAAAGGAGAAAGGAAGAGG + Intergenic
1035714576 8:1744215-1744237 AAGAGAGAGGGGAGAGCCAGCGG + Intergenic
1038680108 8:29658879-29658901 ACGTGAAAGGTGACAGCCACTGG - Intergenic
1039492658 8:37959547-37959569 ACCAGAAAGGGGAGAGAAGGTGG - Intergenic
1039935043 8:42035584-42035606 ACCAGAAAGATGGGAGGAAGGGG + Intronic
1042286802 8:67122281-67122303 ACCAGAAAAATGAGAGCAAACGG - Intronic
1042834144 8:73062858-73062880 ATGGGACAGGTGAGAGAAAGAGG - Intergenic
1043968669 8:86507058-86507080 ACGACAAAGCTGAGAGTAAAAGG + Exonic
1045942918 8:107759561-107759583 ACTAGAAAGGTGTCAGAAAGGGG - Intergenic
1045949953 8:107840422-107840444 ATGAGAGAGGTGAGAGAGAGAGG - Intergenic
1047271304 8:123361942-123361964 AAGAGAAAGGTGGGATTAAGAGG + Intronic
1047359787 8:124158519-124158541 ATAAGAAGGGTGAGAGAAAGGGG + Intergenic
1048246200 8:132803913-132803935 AGGATAAAGATGAGAGAAAGTGG + Exonic
1048269548 8:133017741-133017763 AAGAGAAAGGGGTGAGGAAGGGG - Intronic
1048990860 8:139759398-139759420 ATGAGGAAGGTGAGAGGCAGAGG + Intronic
1049122012 8:140747623-140747645 AGGAGGAAGGGGAGAGGAAGGGG + Intronic
1050977202 9:11954706-11954728 AAGAGAAAACTGAGAGCTAGTGG + Intergenic
1052246597 9:26343391-26343413 AGGAGAATAGTGAGAGAAAGGGG + Intergenic
1052457444 9:28718406-28718428 AAGAGAAAGATAAAAGCAAGAGG - Intergenic
1053391552 9:37739965-37739987 ACGAGAAAACTGAGGGCCAGAGG - Intronic
1053710156 9:40799102-40799124 CCAAGCAAGATGAGAGCAAGTGG + Intergenic
1054420060 9:64919897-64919919 CCAAGCAAGATGAGAGCAAGTGG + Intergenic
1054865056 9:69991443-69991465 AGGAGGAAGGAGAGAGCCAGAGG + Intergenic
1055305417 9:74924202-74924224 ACAGCAAAGGTGAGGGCAAGAGG - Intergenic
1055417930 9:76104353-76104375 AGGAGAAAGGTGATGGAAAGGGG - Intronic
1055753242 9:79530125-79530147 AGAAGAAAAGTGAGAGGAAGAGG - Intergenic
1055848205 9:80593413-80593435 AAGGGAAAGGTATGAGCAAGAGG - Intergenic
1058157300 9:101529744-101529766 AAGGGAAAGGTGAGGACAAGAGG + Intronic
1058782441 9:108351882-108351904 AGGAGATAGGTGAGGGCAATAGG - Intergenic
1058985847 9:110207786-110207808 AGGAGAAAGGTGGGAGACAGTGG + Exonic
1058986480 9:110212695-110212717 TCTAGAAAGTAGAGAGCAAGGGG - Intergenic
1059154077 9:111974734-111974756 AGGTGAAAGCTGAGAGCAGGTGG - Intergenic
1059465815 9:114468210-114468232 AAGAGACAAGTGAGAGCATGTGG + Intronic
1059744095 9:117183531-117183553 ACGAGGACAGTGAGAGGAAGGGG + Intronic
1062604405 9:137338941-137338963 ATGAGAAGAGTGAGAGCAAAAGG + Intronic
1185655541 X:1681648-1681670 AAGAGAGAGGAGAGAGAAAGAGG - Intergenic
1186092778 X:6067627-6067649 ATGGGAAAGGAGAGAGCAGGGGG - Intronic
1187359039 X:18607235-18607257 AGGTGAAAGGAGAAAGCAAGAGG + Intronic
1191005896 X:55711382-55711404 ACGAGAAAGTTGAGAGCTGATGG - Intergenic
1191024138 X:55895171-55895193 AAGATGAAGGAGAGAGCAAGGGG + Intergenic
1193612169 X:83645374-83645396 ACTAGAGAGGTGAGAGAAGGAGG - Intergenic
1194029062 X:88789335-88789357 AGAAGAAAGGGGAGAGGAAGGGG + Intergenic
1194869038 X:99104910-99104932 AAGAAAAAGGTGAGGCCAAGAGG - Intergenic
1195373902 X:104206690-104206712 ACGACAAAAGTCAGAACAAGAGG + Intergenic
1196889835 X:120281309-120281331 CCCAGAACGTTGAGAGCAAGGGG - Intronic
1197293921 X:124694053-124694075 AAGAGAAAGAAGAAAGCAAGAGG - Intronic
1197721644 X:129748983-129749005 AGGAGAAAGGAGAGTGCAAAGGG + Intronic
1199698550 X:150360883-150360905 CTGAGGAAGATGAGAGCAAGTGG + Intergenic
1200813514 Y:7508276-7508298 ACGAGGAAATTGAGACCAAGAGG + Intergenic
1201594641 Y:15654191-15654213 AGCAGAAAGGTTAGAGCTAGAGG + Intergenic