ID: 988609646

View in Genome Browser
Species Human (GRCh38)
Location 5:32712430-32712452
Sequence GGGGGTCCACGAGGTCTTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988609646 Original CRISPR GGGGGTCCACGAGGTCTTCC AGG Exonic
900343573 1:2200202-2200224 GGGGTTTCACGATGTCTTTCAGG - Intronic
901086058 1:6613278-6613300 GGGGGTCCCCGAGGCCTGGCCGG - Intronic
902390799 1:16104295-16104317 GGGGGTCCTCGGGATCCTCCCGG + Intergenic
902633296 1:17718717-17718739 GGAGGTCAGGGAGGTCTTCCTGG + Intergenic
903811299 1:26036364-26036386 GGGGGGACACTAGGTCCTCCGGG + Exonic
904602162 1:31679666-31679688 CAGGGTCCACCAGGTATTCCCGG - Exonic
905168869 1:36098590-36098612 GGGGGTCCCCCTGGACTTCCTGG - Exonic
905336772 1:37249952-37249974 GGTGGTCCAGGAAGTCATCCTGG + Intergenic
905648565 1:39640981-39641003 GGGCGACCACCAGGGCTTCCTGG - Intergenic
905953711 1:41974681-41974703 GGGGGTTCAGGAAGGCTTCCTGG - Intronic
906704524 1:47885288-47885310 GGGAGTCAGCGAGGGCTTCCTGG - Intronic
907194888 1:52678524-52678546 GAGGGTCCAGGATGACTTCCTGG + Intergenic
914768147 1:150658122-150658144 GGGGGTCCTCGGGATCCTCCCGG - Intronic
921217609 1:212950867-212950889 CGGGGTCCGGGAGGGCTTCCTGG + Intronic
922722030 1:227904209-227904231 GGGGTCCCACGAGGCCTGCCTGG - Intergenic
924707035 1:246509964-246509986 GGGGGTCCCCATGGGCTTCCGGG + Intergenic
924765510 1:247028560-247028582 GGGGGTCCTCGGGATCATCCCGG - Intergenic
1062812068 10:474484-474506 GGGGCTCCAAGAGGACTTCCAGG - Intronic
1063388902 10:5635797-5635819 TGGGCTCCCCGTGGTCTTCCAGG - Intergenic
1063593409 10:7412196-7412218 AGGGGGCCAAGAGGTCCTCCAGG + Intergenic
1064007820 10:11712467-11712489 GGGGGATCAGGAGTTCTTCCTGG - Intergenic
1066989633 10:42500621-42500643 GGGGGTCCTCGGGATCCTCCTGG - Intergenic
1071436823 10:85655147-85655169 GAGTGTGCAAGAGGTCTTCCAGG - Intronic
1072768337 10:98114851-98114873 CTGGGTCCAAGAAGTCTTCCTGG + Intergenic
1073514081 10:104061677-104061699 GGGGGTCTAGGAGGACTTCCTGG - Intronic
1076314003 10:129527999-129528021 GGGAGTCCAGGAAGGCTTCCTGG - Intronic
1077477339 11:2796704-2796726 GGAAACCCACGAGGTCTTCCTGG - Intronic
1078009940 11:7565244-7565266 TGGGGTCCAGGTGGCCTTCCAGG + Intronic
1079013968 11:16853485-16853507 GGGTGTCCAGAAGGGCTTCCCGG - Intronic
1084179756 11:67440421-67440443 TGGGTTCCTCGAGGTTTTCCTGG + Exonic
1088923908 11:114281461-114281483 GGAGGTCAATGAAGTCTTCCTGG + Intronic
1089601575 11:119618720-119618742 GGGAGTCCAGGAAGGCTTCCTGG - Intergenic
1089638985 11:119834526-119834548 GGGGCTCAAGGAGGACTTCCTGG - Intergenic
1089655891 11:119946698-119946720 AGGAGTCCAGGAGGACTTCCAGG + Intergenic
1089673440 11:120073081-120073103 GGGGGTCAGGGAGGTCTCCCAGG + Intergenic
1089770080 11:120796542-120796564 GGGGGTCAGAGAGGGCTTCCTGG + Intronic
1092211699 12:6650724-6650746 GGGGATCCACCAGGTCATCTAGG - Exonic
1093077262 12:14770895-14770917 GGGAGTCCTCAAAGTCTTCCTGG - Exonic
1096450397 12:51735744-51735766 GGGGGTCCTCGGGATCCTCCTGG + Intronic
1096555743 12:52402591-52402613 GGGAGTCCAGGAAGCCTTCCTGG - Intronic
1101439617 12:104693689-104693711 GGGGGTCAGGGAGGGCTTCCTGG + Intronic
1102103580 12:110300563-110300585 GGAGGATCACGAGGTCATCCTGG - Intronic
1102245541 12:111353514-111353536 TGGGGTCCAGGAAGGCTTCCTGG + Intergenic
1102469603 12:113152370-113152392 GGTGGTCAAGGAGGGCTTCCTGG + Intronic
1103316921 12:120063738-120063760 GAGGATCCACGAGGACCTCCAGG + Intronic
1103800560 12:123534306-123534328 GGGGGTCCCCGTTCTCTTCCTGG - Intergenic
1103994477 12:124820373-124820395 AGGAGTCCGGGAGGTCTTCCTGG + Intronic
1104848448 12:131858878-131858900 GTGGGTCCTTGAGGGCTTCCAGG + Intergenic
1104945758 12:132414289-132414311 GGGAGACCCTGAGGTCTTCCCGG - Intergenic
1106660505 13:31794732-31794754 GGGAATCCACTATGTCTTCCTGG - Intronic
1110289451 13:73786978-73787000 GGTGGTCCAGGAGGGCTTCATGG - Intronic
1114846101 14:26324003-26324025 GGGGGTCCAGGTGGTCCTGCTGG - Intergenic
1116938812 14:50770127-50770149 GCGGGTTCACTAGGTCTTCAGGG - Intronic
1117939779 14:60950452-60950474 TGGGGTGGACGAGGTTTTCCTGG - Intronic
1121280095 14:92691871-92691893 GGGGGCTCACGAGGGCTCCCTGG + Intergenic
1122071830 14:99209947-99209969 GGGGGGCTCAGAGGTCTTCCTGG - Intronic
1122156539 14:99753505-99753527 TGGGGACCACAAGGTGTTCCAGG - Intronic
1122366461 14:101197607-101197629 GTGGCTCCAGGAGGGCTTCCTGG + Intergenic
1123932678 15:25179406-25179428 GGGGGTCCACAGGGTCTCCAGGG + Intergenic
1124590853 15:31051677-31051699 GGGGGTCAATGAGGTCGTCAAGG - Intronic
1129016747 15:72474993-72475015 GGAGGTCAACGAGGTCATCCAGG + Exonic
1129697453 15:77748640-77748662 TGGGGTCCATGACCTCTTCCTGG - Intronic
1130540231 15:84817009-84817031 AGGGGTCCACGAGGCCTGGCCGG - Exonic
1132498751 16:275671-275693 GGGGGTCTCCGGGGTCTCCCCGG - Intronic
1132528117 16:427452-427474 AGGGGTCCACGCGGTCCTCAGGG + Intronic
1132851359 16:2026464-2026486 GGGGGTCCGGAAGGGCTTCCCGG + Intronic
1135201381 16:20440436-20440458 GGAGGTCTACGGGGCCTTCCTGG - Exonic
1135217728 16:20587427-20587449 GGAGGTCTACGGGGCCTTCCTGG + Intergenic
1135586991 16:23679052-23679074 GTGGGTCCACTAGGACCTCCGGG - Exonic
1137724988 16:50651003-50651025 GGGGGTCAGGGAGGGCTTCCTGG - Intergenic
1138802292 16:60048095-60048117 GGGGTTTCACCAGGTCATCCAGG - Intergenic
1141074550 16:80991613-80991635 CAGGGTCCACTATGTCTTCCAGG - Intronic
1141099852 16:81189235-81189257 CGGGGTACACGGGGTGTTCCTGG + Intergenic
1142023057 16:87795997-87796019 GGGGGTCCAGGAGGTTCCCCAGG + Intergenic
1143619044 17:8070737-8070759 GGGAGTCCCTGAGGTCTTCAAGG - Intergenic
1146010791 17:29192715-29192737 GGGAGTCCACTAGTTCTTCAAGG + Intergenic
1146536407 17:33656651-33656673 GAGGTTCCAGGAGGCCTTCCTGG - Intronic
1147628931 17:41918012-41918034 GGGGTCCCTGGAGGTCTTCCTGG - Intronic
1147840637 17:43369050-43369072 GGGGGTCCAGGAGGTGACCCAGG + Intergenic
1151745494 17:76009601-76009623 GCGCGTCCACGAGATCTTCCAGG - Exonic
1154486342 18:14874655-14874677 GGGTGGCCAAGAGGTCTTTCTGG - Intergenic
1155199263 18:23503303-23503325 GGGGAACCACGCGGGCTTCCGGG + Intergenic
1157576742 18:48748747-48748769 TGAGGTCCAGGAGGGCTTCCTGG + Intronic
1157742379 18:50105007-50105029 GGGGGTACACGAGGACATCTAGG + Intronic
1161323884 19:3653708-3653730 CGGGGTCCCCGAGGGCTTCTGGG - Intronic
1161352895 19:3803671-3803693 GAGGCTCCCCGAGGGCTTCCTGG - Intergenic
1161455922 19:4369687-4369709 GGGGGTTCAGGAAGTCGTCCTGG - Intronic
1161502403 19:4623653-4623675 GGCGGTCCGGGAGGGCTTCCTGG - Intergenic
1161504775 19:4638190-4638212 GGGGTTCCACGATGTTGTCCAGG + Intergenic
1161687753 19:5711788-5711810 CGTTGTCCACGAGGACTTCCAGG - Exonic
1161770321 19:6227338-6227360 GTGGGGCCACGCGGCCTTCCGGG + Intronic
1161800613 19:6415262-6415284 GGGGGTCCAGGAGCTCCCCCAGG - Exonic
1162577400 19:11506944-11506966 GGGGGGTCAGGAGGCCTTCCTGG - Intronic
1163444109 19:17336884-17336906 GGGGTTCCAGGAAGACTTCCTGG + Intronic
1163827362 19:19531076-19531098 GGGAGTCAGCGAGGGCTTCCTGG - Intronic
1164035975 19:21455407-21455429 GGGGTTTCACTCGGTCTTCCAGG - Intronic
1165751558 19:38263748-38263770 GGGAGTCAAAGAGGGCTTCCTGG - Intronic
1165758394 19:38307264-38307286 GGGGGGTCAGGAGGGCTTCCTGG - Intronic
1166159182 19:40938964-40938986 TGGGGTCCACGAGGGCTCCTAGG - Intergenic
1166659625 19:44637813-44637835 GAGGATCCAGGAGGGCTTCCTGG + Intergenic
1166663089 19:44660008-44660030 GGGGGTCAGGGAGGGCTTCCTGG - Intronic
1166667551 19:44689993-44690015 GGAGGTCAAGGAGGGCTTCCTGG - Intergenic
1166673049 19:44722924-44722946 TGGGGTCAAGGAGGGCTTCCTGG + Intergenic
1166784422 19:45359140-45359162 GGGGGTCAGGGAGGGCTTCCTGG + Intronic
1166876390 19:45900429-45900451 GGTGGTCCAGGAGGGCTTCCTGG - Intronic
1167153391 19:47723063-47723085 GGGGGTCAAGGAGGACTTCCAGG - Intronic
1167334075 19:48873961-48873983 GGGGGACACGGAGGTCTTCCTGG - Exonic
1167491263 19:49793754-49793776 GTGAGTCCACGAAGGCTTCCTGG + Intronic
1168516727 19:57015371-57015393 GCCGGTCAAGGAGGTCTTCCTGG - Intergenic
925132425 2:1503265-1503287 TGGGGAACACGAGCTCTTCCAGG - Intronic
927118327 2:19926886-19926908 GGGGGTCCTCGAGATCCTCCCGG - Intronic
927487721 2:23500231-23500253 GGGAGTCCAGGAGGGCTTCATGG + Intronic
927495294 2:23547878-23547900 GGTGGTCCAGGAAGGCTTCCAGG + Intronic
927667301 2:25041817-25041839 TGGGGTCCTCGAGGTCAGCCGGG - Intergenic
927698204 2:25251774-25251796 GGGGGACCACGCGGTCCTCAGGG - Intronic
928186826 2:29117710-29117732 GAGGGTCAACGAAGGCTTCCTGG - Intronic
931428649 2:62193049-62193071 GGGAGTCCATGAGGAGTTCCTGG - Intergenic
932334525 2:70922536-70922558 AGGGGACCAGGAGGACTTCCAGG - Intronic
932777810 2:74539021-74539043 GGGGGTCCAGGAGGCCTTTGTGG - Intronic
933935332 2:87199246-87199268 GGGAGGCAACGAAGTCTTCCTGG - Intergenic
936357816 2:111766653-111766675 GGGAGGCAACGAAGTCTTCCTGG + Intronic
937332613 2:121041729-121041751 GGGAGTCAAGGAGGGCTTCCTGG - Intergenic
937956918 2:127426784-127426806 TGGGGGCCACAAAGTCTTCCTGG + Intronic
937986936 2:127642199-127642221 GGGGCTGCACGCTGTCTTCCAGG - Exonic
946401978 2:219473002-219473024 GGGGGTCCAGCACATCTTCCGGG + Exonic
947166097 2:227263896-227263918 GCTGGTTCACCAGGTCTTCCAGG + Exonic
948345207 2:237290534-237290556 GGGGGTAGACGAGCTCTCCCTGG - Intergenic
948766425 2:240223921-240223943 GGGGGTCCTGGAAGTCTTCATGG - Intergenic
948768844 2:240236999-240237021 AGGTGTCCATGAGGGCTTCCAGG - Intergenic
1169137068 20:3203815-3203837 GGAGATCCAGCAGGTCTTCCCGG - Intronic
1169403875 20:5307083-5307105 GGGGGTCCTCGGGATCCTCCTGG - Intronic
1170763633 20:19272944-19272966 GAGGGTCCAGGAAGGCTTCCTGG + Intronic
1171220615 20:23393716-23393738 GGGGATCTACTATGTCTTCCTGG + Intronic
1172620312 20:36314101-36314123 GGGAGTGCACAAGGCCTTCCAGG + Intronic
1172803220 20:37592800-37592822 GGAGGTGCAGGAGGGCTTCCTGG + Intergenic
1172847339 20:37937833-37937855 GGGGGGCCAGGAGGGCTTCCTGG + Intronic
1174462289 20:50691441-50691463 GGGGCCCCAGGAGGGCTTCCTGG - Exonic
1175317105 20:58056241-58056263 GAGGGTCCACGAGGTGATGCAGG - Intergenic
1175423543 20:58850798-58850820 AGCGGTCCTCGTGGTCTTCCAGG + Intronic
1175699180 20:61124830-61124852 GGGAGTCCCAGAGGTCTGCCAGG + Intergenic
1176215191 20:63944548-63944570 TGGGGACCACGATGTCTGCCAGG + Exonic
1176794960 21:13364725-13364747 GGGTGGCCAAGAGGTCTTTCTGG + Intergenic
1179427596 21:41294264-41294286 GGAGGACCAGGAGGGCTTCCAGG - Intergenic
1179888970 21:44326366-44326388 GGGGGCCCAGGAGGCCTTGCGGG - Intronic
1179912341 21:44456812-44456834 GGAGGTCCCCGAGGACATCCCGG + Exonic
1180749066 22:18111702-18111724 AGGGGTCCAGGAGGGATTCCTGG - Intronic
1181107549 22:20584018-20584040 GGTGGTCCTCCAGGTCTTCATGG + Intronic
1182067263 22:27439359-27439381 GGTGGTCAAGGAGGGCTTCCTGG - Intergenic
1182287267 22:29255753-29255775 GGGGGTCAGGGAGGTCTTCCTGG + Intronic
1182991897 22:34776233-34776255 GGGATTCCAAGAGGACTTCCTGG + Intergenic
1183395436 22:37568563-37568585 GGGGGTCCCCGAGGACCTGCTGG + Exonic
1184797167 22:46738908-46738930 TGGGGTCAAGGAGGCCTTCCTGG - Intergenic
1185372208 22:50466167-50466189 TGGGGTCAACGCGGCCTTCCAGG - Exonic
950202225 3:11052968-11052990 GAGAGTCCAAGATGTCTTCCTGG - Intergenic
953855549 3:46497103-46497125 GGGGGATGAGGAGGTCTTCCAGG - Intergenic
953932011 3:47010151-47010173 GAGAGTCCACGTTGTCTTCCCGG + Intergenic
954154078 3:48675072-48675094 GAATGTGCACGAGGTCTTCCAGG - Intronic
956001799 3:64737770-64737792 GGGGGTCCAGGAAGGCTTTCTGG + Intergenic
962277873 3:134029679-134029701 CGGAGTCCGCGGGGTCTTCCGGG - Intronic
962309342 3:134314173-134314195 GGAGATCCAGGAGGGCTTCCTGG + Intergenic
966009079 3:175053484-175053506 GGGGGTCCTCGAGATCCTCCTGG + Intronic
966681319 3:182644661-182644683 GGGGATCCACAAAGCCTTCCTGG - Intergenic
967792290 3:193562129-193562151 TGGGGTCCAGGAGAGCTTCCAGG - Intronic
967894843 3:194387467-194387489 AGGGGTGCAGGAGGCCTTCCAGG - Intergenic
968061518 3:195729691-195729713 TGGGGTCAGTGAGGTCTTCCGGG - Exonic
968589317 4:1449763-1449785 GGGGGTCCCCGGAGTCTTCCCGG + Intergenic
968745894 4:2359924-2359946 GGGGGTCCCCAGGGTCTTTCAGG - Intronic
968962686 4:3753349-3753371 AGGGGTGCAGGAGGGCTTCCTGG + Intergenic
969354037 4:6614685-6614707 GGGGCTCCAGGAGGTTTCCCTGG - Intronic
970011607 4:11465401-11465423 GGTGGTCCTGGAGGTCTTCTGGG - Intergenic
971056208 4:22915466-22915488 GGGGTTCCACTACGCCTTCCAGG + Intergenic
984956019 4:185046264-185046286 GGGGGTCCTCGGGATCCTCCTGG + Intergenic
985735630 5:1579405-1579427 GGGGGTCCTCGGGATCCTCCCGG + Intergenic
986616294 5:9620897-9620919 GGGGTTTCACCACGTCTTCCAGG - Intergenic
986707440 5:10463544-10463566 TGGGGTCCCTGAGGTCTTCCCGG + Intronic
987126238 5:14815527-14815549 GGAGGTCCACCAGGGTTTCCAGG + Intronic
988609646 5:32712430-32712452 GGGGGTCCACGAGGTCTTCCAGG + Exonic
988810804 5:34783349-34783371 GGGGGTCCTCGGGATCCTCCTGG + Intronic
989742761 5:44791913-44791935 GGGGGTCCTCGGGATCCTCCTGG - Intergenic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
992266263 5:75021141-75021163 GGGGGTCCTCGAGATGTTCAAGG - Intergenic
998878648 5:146625622-146625644 GGGGGTCCAGGAAGTCTTCCTGG + Intronic
1001227100 5:169954492-169954514 GGGTGGCCAAGAGGTCTTTCTGG - Intronic
1001647718 5:173294770-173294792 AGGGGGCCAGGAGGGCTTCCTGG + Intergenic
1002098634 5:176846532-176846554 GGGCATCCAGGAGGGCTTCCTGG - Intronic
1002158640 5:177302284-177302306 GGTGCTCTAGGAGGTCTTCCTGG - Intronic
1003019494 6:2497298-2497320 GTGGGGCCACCAGGTCCTCCAGG - Intergenic
1006038358 6:31232265-31232287 GGGGGTCCTCGGGATCCTCCTGG + Intergenic
1006614010 6:35312490-35312512 GGCCATCCACGAGGTCTACCAGG + Exonic
1007133540 6:39499258-39499280 GGAGGTGCAAGAGGGCTTCCTGG + Intronic
1008648901 6:53544360-53544382 GGGGGTCCTCGAGCGCCTCCCGG - Intronic
1009247170 6:61252817-61252839 GGGGGTCAAGGAGGATTTCCTGG - Intergenic
1009928633 6:70149848-70149870 CAGGGTCCTCGAGGTCTCCCTGG + Exonic
1014432627 6:121388684-121388706 TGTGGTCCAGGAGGGCTTCCTGG - Intergenic
1019295986 7:275627-275649 GGGGGTCCTCAGGGGCTTCCAGG - Intergenic
1019354420 7:571312-571334 GGGTGTGCACGGGGTCCTCCAGG + Intronic
1019390596 7:784431-784453 GGGGGTCCAGGAGGACCTCAAGG - Intronic
1019530455 7:1500432-1500454 TGGGTTCCTCGTGGTCTTCCCGG - Intronic
1020774552 7:12436492-12436514 GAGGGTCAAAGATGTCTTCCAGG - Intergenic
1021378030 7:19932746-19932768 GGGAGTCCTTGAGGACTTCCTGG + Intergenic
1024101798 7:46039732-46039754 GGAGGTCCTCGAGATCCTCCCGG + Intergenic
1025010768 7:55396236-55396258 GGAGCTCCACCAGGTCTTCATGG + Intronic
1027185485 7:75968412-75968434 GAGGGTGCATGAGGCCTTCCTGG - Intronic
1034942477 7:155239684-155239706 GGGGGTCCTCGGGATCCTCCTGG + Intergenic
1035630380 8:1103086-1103108 GGGGGTCTCTGAGGTTTTCCGGG + Intergenic
1036538553 8:9677964-9677986 GGGGGTCAAGGAAGCCTTCCTGG - Intronic
1037193352 8:16155072-16155094 AGTGGTCCACGAGGATTTCCAGG - Exonic
1041019319 8:53622483-53622505 AGGGGTCCTCGAGTTCCTCCCGG - Intergenic
1041609353 8:59826573-59826595 GGGGGTACAGGTGGGCTTCCAGG - Intergenic
1041830191 8:62144648-62144670 GCGGGTCCACTAGGACCTCCGGG + Intergenic
1044442767 8:92241107-92241129 GGGGGTCCTCGGGGTCCTCCTGG - Intergenic
1047889230 8:129289245-129289267 TGGTGTCCATGAGGTATTCCAGG + Intergenic
1048575385 8:135685988-135686010 GCAGGGCCAAGAGGTCTTCCTGG - Intergenic
1049220493 8:141426685-141426707 GGTGGTCCAGGAAGGCTTCCTGG + Intronic
1049586466 8:143434760-143434782 GGGGGCCCACGATGACTTCCTGG - Intergenic
1053298857 9:36934670-36934692 GGGAATCCATGAGGGCTTCCTGG - Intronic
1053887266 9:42653467-42653489 GGGTGGCCAAGAGGTCTTTCTGG - Intergenic
1054226287 9:62460918-62460940 GGGTGGCCAAGAGGTCTTTCTGG - Intergenic
1057291911 9:93812296-93812318 GGTGGCCCAGGAGGGCTTCCTGG + Intergenic
1058910898 9:109518978-109519000 GGGGCTCCAGGAAGTCTTCCTGG - Intergenic
1059421807 9:114196882-114196904 GGTGCTCCAGGAGGACTTCCTGG - Intronic
1060751193 9:126170586-126170608 GAAGGGCCAGGAGGTCTTCCTGG + Intergenic
1061301863 9:129710084-129710106 GTGGGTCCAGGAGGGCTTCTTGG + Intronic
1062567827 9:137171121-137171143 GCAGGTCCATGAGATCTTCCTGG + Exonic
1062592569 9:137280837-137280859 AGGCGTCCAGGAGGGCTTCCGGG - Exonic
1186426439 X:9466407-9466429 GGGGGAACACGAGGCCTTGCAGG - Intronic
1192033469 X:67539778-67539800 GGTGGTTCAGGAAGTCTTCCTGG + Intergenic
1196550552 X:117018579-117018601 GGGGTTTCACGATGTTTTCCAGG - Intergenic