ID: 988614692

View in Genome Browser
Species Human (GRCh38)
Location 5:32764163-32764185
Sequence CCTAAACTGCACATGCACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988614692_988614698 16 Left 988614692 5:32764163-32764185 CCTTCGTGCATGTGCAGTTTAGG 0: 1
1: 0
2: 1
3: 7
4: 49
Right 988614698 5:32764202-32764224 CAGAAGTTTATGAAAGACTTGGG 0: 1
1: 0
2: 2
3: 33
4: 261
988614692_988614697 15 Left 988614692 5:32764163-32764185 CCTTCGTGCATGTGCAGTTTAGG 0: 1
1: 0
2: 1
3: 7
4: 49
Right 988614697 5:32764201-32764223 GCAGAAGTTTATGAAAGACTTGG 0: 1
1: 0
2: 2
3: 14
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988614692 Original CRISPR CCTAAACTGCACATGCACGA AGG (reversed) Intronic
900568061 1:3344948-3344970 CCTGAATTGCTCATGCATGAGGG - Intronic
905771404 1:40640284-40640306 CCTAAACTGCATATTCACAGAGG + Intronic
913506007 1:119516738-119516760 TCTCAACTGAACAAGCACGAAGG + Intergenic
923958043 1:239044573-239044595 CATAAACAGCACATACACTATGG + Intergenic
924836243 1:247650366-247650388 CCTAAACTCCACAGGGATGAGGG + Intergenic
1063956634 10:11273366-11273388 TCTAAACTGCACATGCTGAAGGG + Intronic
1067082904 10:43221637-43221659 CCTAACCTGCAAATGCAGCAGGG - Intronic
1073876504 10:107928554-107928576 CTTAAACAGCACATACACCAAGG + Intergenic
1077544525 11:3163627-3163649 CCTCCACTGGACATGCAGGATGG + Intronic
1086173205 11:83859848-83859870 CCTAGACTGCACACGGAAGAGGG - Intronic
1087261938 11:96021714-96021736 CTTACACTGTACGTGCACGATGG - Intronic
1099488177 12:83253489-83253511 CCTAACCTGCACATACACATAGG + Intergenic
1113653217 13:112052520-112052542 CCTGAACGGCACATGCACCTCGG + Intergenic
1122165392 14:99819576-99819598 TCTAAACTTCACGTGCACGCTGG - Intronic
1124695078 15:31857636-31857658 CATAAACAGCACATGCTCCAGGG + Intronic
1126340999 15:47641155-47641177 CCCAAGCTGCACATGCAGGTGGG - Intronic
1129099730 15:73249085-73249107 GCGAAGCTGCATATGCACGAAGG - Exonic
1129949036 15:79570028-79570050 TCTCAACTGAACATGCACAATGG + Intergenic
1132857520 16:2053436-2053458 CCTTACCTGCCCCTGCACGATGG - Exonic
1146624121 17:34423123-34423145 CCAGAACTGCACATGCAGTAGGG + Intergenic
1147626160 17:41901565-41901587 CCCAAACTGCACACCCAGGAAGG + Intronic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1152591750 17:81216996-81217018 CCTAAACTCCACCTGCAAGAAGG + Intronic
1153335562 18:3920485-3920507 CATAAACTGAACATGCCCGGTGG - Intronic
1153580597 18:6569835-6569857 CCTAATCTGCAGTTGCAGGAAGG + Intronic
1154206705 18:12343622-12343644 ACTAAACTACACATGCACAGTGG - Intronic
1162657381 19:12141120-12141142 CCTGAAGTGCACCTGCACGTGGG + Intronic
1164544759 19:29151106-29151128 CCTAAACTGCATGTGAATGATGG + Intergenic
925025616 2:604669-604691 CCTAAACTGTACACACACGCAGG + Intergenic
937082904 2:119153264-119153286 ACTAAACTACACTTGCAGGATGG + Intergenic
940863954 2:158798305-158798327 CATAAACTGCATATGGACCACGG + Intronic
944565291 2:200984325-200984347 ACTAAACTGGCCAGGCACGATGG - Intronic
1173185491 20:40836936-40836958 CCTAAACTCCACATACACGATGG + Intergenic
1176674122 21:9761396-9761418 GCTAAAGTACACATGCATGAGGG - Intergenic
1184893307 22:47392679-47392701 CCTACAGAGCACATGCACAAAGG - Intergenic
950603999 3:14061989-14062011 TCCAAACTGCACAAGGACGAAGG + Intronic
951071488 3:18333912-18333934 ACTACACTGTACATTCACGAAGG - Intronic
956461174 3:69474050-69474072 TCTAAACTGCAAATGCCCAAGGG + Intronic
961628104 3:128277646-128277668 CCTAATCTACACATCCACAATGG - Intronic
973145595 4:46821612-46821634 CCTATACTACACATGTAGGAAGG + Intronic
980299117 4:130965153-130965175 CCTAAACTGCACATAGCCGAGGG - Intergenic
981469077 4:145109141-145109163 CCAAAACTTCACCTGGACGAGGG - Exonic
984408803 4:179369541-179369563 CCTCAACTGCAAAAGGACGAGGG - Intergenic
988614692 5:32764163-32764185 CCTAAACTGCACATGCACGAAGG - Intronic
993908347 5:93649416-93649438 GCTAGCCTGCACATGCAGGAAGG - Intronic
996752505 5:126903214-126903236 CCTCAACTGTAAATGCAGGAAGG + Intronic
998725702 5:145011256-145011278 CCTAAACTTCACATGCTAGTTGG + Intergenic
1005163013 6:22886971-22886993 CTTAAACTGCACATGTAAGATGG - Intergenic
1016314693 6:142772529-142772551 CCCAAACTGCAGATGCAGGAAGG - Exonic
1016564875 6:145441293-145441315 CCTAAACTGCACACAGAAGAAGG + Intergenic
1023536336 7:41216333-41216355 CCAAAACTGCAGAAGCATGAAGG - Intergenic
1029899894 7:104028105-104028127 GCTTAACTGCAAATGCAGGATGG + Intergenic
1041569712 8:59323705-59323727 CCTAAACTGTACTGGCAGGAGGG - Intergenic
1042885148 8:73541014-73541036 GCTAAACTTCACATGCACAAGGG + Intronic
1060974210 9:127755073-127755095 CCTCACCTGCACCTGCACGAAGG + Intronic
1187959196 X:24552123-24552145 CCTAAACTGCACATACTTTATGG - Intergenic
1197441560 X:126496921-126496943 CCTAAACTCCGAATGCACAAGGG + Intergenic
1198707192 X:139462161-139462183 CCTAAACTGCACATGGCAGAGGG - Intergenic