ID: 988616043

View in Genome Browser
Species Human (GRCh38)
Location 5:32775852-32775874
Sequence TGTTATTAAGAAAGCTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988616043 Original CRISPR TGTTATTAAGAAAGCTTGGG AGG (reversed) Intronic
903783783 1:25842244-25842266 TGATATGAAGAAAGTTTGAGTGG + Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
907073758 1:51560642-51560664 ACTTATTAAGAAAGATGGGGAGG - Intergenic
908079375 1:60559639-60559661 TGTTTATAAGAAGGCTTGGCAGG - Intergenic
908333234 1:63092753-63092775 TGATATGCAGAAAGCTTGAGTGG - Intergenic
909081343 1:71116333-71116355 TATAATTAAGAAAGATAGGGTGG + Intergenic
909241254 1:73216803-73216825 TGTAAGTATGAAATCTTGGGGGG - Intergenic
909447904 1:75767969-75767991 TGTTATTGAGACAGCTTTGTAGG + Intronic
910536562 1:88304682-88304704 TGTTAGGAAGAAAGCAAGGGAGG - Intergenic
911246808 1:95526926-95526948 TGTTTTTAAGAAAGTTTTTGAGG + Intergenic
914260533 1:145995536-145995558 TGTGATAAGGAATGCTTGGGTGG + Intronic
914801798 1:150967678-150967700 TGACATGAAGAAAGTTTGGGAGG - Exonic
916282193 1:163064038-163064060 TTCTAGAAAGAAAGCTTGGGAGG - Intergenic
917095618 1:171396348-171396370 TGTAATAAATAAAGTTTGGGGGG + Intergenic
919266511 1:195274155-195274177 TGTTATTATGACAGATTGAGTGG + Intergenic
920642514 1:207766763-207766785 TTTTCTTAAGAAAACTTGGCTGG - Intronic
921292185 1:213669024-213669046 TGATATGAAGAAAGTTTGAGTGG - Intergenic
922650492 1:227334088-227334110 TCTTAAAAAGAAAGGTTGGGGGG + Intergenic
922761848 1:228137937-228137959 TGTTTTTAAAAAATCATGGGAGG + Intergenic
923323935 1:232863777-232863799 CCTTATTAAAACAGCTTGGGTGG - Intergenic
923763188 1:236866741-236866763 TGTTATGAGGAAAGTTTGAGTGG + Intronic
923781416 1:237028404-237028426 TGTTCTTAAGAAAGTGTGTGTGG - Intergenic
1062888124 10:1035007-1035029 TTTTATTGAGGAAGCTTGAGAGG - Intergenic
1066057032 10:31691578-31691600 TGATATGGAGAAAGCTTGAGTGG - Intergenic
1066310798 10:34194076-34194098 GGTTATTTATGAAGCTTGGGTGG - Intronic
1066569666 10:36757092-36757114 TATTATTAAGAATGCATGTGAGG + Intergenic
1068140823 10:53004867-53004889 TGGTATTAGTAAAGCTTTGGGGG + Intergenic
1068233391 10:54200539-54200561 TGGGTTTAAGAAAACTTGGGAGG - Intronic
1068797191 10:61096414-61096436 AGTTTATAAGGAAGCTTGGGTGG - Intergenic
1071106924 10:82108941-82108963 TTTTAATAACAAACCTTGGGAGG + Intronic
1072957133 10:99897245-99897267 TGTTATGAAGAAGGAGTGGGTGG + Intronic
1073909461 10:108324522-108324544 TGTTTTTAAGTAAGGTGGGGAGG + Intergenic
1074286621 10:112103905-112103927 GTTTATTAAAAAAGCTTTGGTGG + Intergenic
1074760202 10:116661775-116661797 TGTTTTTAAAAAAGGGTGGGGGG - Intergenic
1078066580 11:8082744-8082766 TGCTTTTAAGAAGCCTTGGGCGG - Intronic
1078118100 11:8476111-8476133 TGTTAGTAAGAAAGAATGAGAGG - Intronic
1078139869 11:8684101-8684123 TTTTATTGACACAGCTTGGGAGG + Intronic
1078816267 11:14825223-14825245 GGTTATTAAGCCAGCTTGTGTGG - Intronic
1080123625 11:28705466-28705488 TGATATTGAGAAAGTTGGGGTGG - Intergenic
1080308751 11:30865878-30865900 TGCTATGAAGAAGGCTTGTGTGG + Intronic
1081157481 11:39713065-39713087 TGACATCAAGTAAGCTTGGGCGG + Intergenic
1081877810 11:46422012-46422034 TGTTCAGAACAAAGCTTGGGTGG + Intronic
1081929623 11:46859897-46859919 TGTTAAGGAGAAAACTTGGGAGG + Intronic
1082053001 11:47788028-47788050 TCTTTTTAAGAATGCTTGGATGG + Intronic
1082200724 11:49363352-49363374 TGTTACTAAGAAAGAATGGGAGG + Intergenic
1083500464 11:63102546-63102568 TGTTTTTGAGAAATCTTTGGTGG + Intronic
1083590813 11:63893168-63893190 AGAAATTAAGAAATCTTGGGAGG - Intronic
1085439612 11:76546889-76546911 TGTTATTAAAAAATCTTGTTTGG + Intronic
1086654946 11:89342903-89342925 TGTTACTAAGAAAGAATGGGAGG - Intronic
1088947743 11:114531909-114531931 TATTTTTAAAAAAGCTTGGCCGG - Intronic
1089990606 11:122855964-122855986 TGCTATTAGGAAAGCTTTGTTGG - Intronic
1091648236 12:2289996-2290018 AGTTAGTAATAAAGCTTGGGTGG + Intronic
1091812125 12:3408531-3408553 TGTTCTTAAGAAAGCTCAGTTGG - Intronic
1096122668 12:49098235-49098257 TGCTCTTGAGACAGCTTGGGTGG - Intronic
1098015608 12:66100874-66100896 TGTTATTAATAAATATTGGGAGG - Intergenic
1098020619 12:66151533-66151555 TAATATTAAGAATACTTGGGTGG - Intronic
1098641290 12:72840517-72840539 TGTGATTAAGAATGCTTGCTGGG - Intergenic
1099128057 12:78791197-78791219 TGTTATCTAGAAAGCTGGCGTGG - Intergenic
1100138119 12:91580493-91580515 TGTTTTTAAGAGATGTTGGGAGG + Intergenic
1101701075 12:107174598-107174620 TGGTATACACAAAGCTTGGGAGG - Intergenic
1102485683 12:113254115-113254137 TCTTATTGAGAAAGCTTTGGTGG - Intronic
1103737663 12:123070738-123070760 GGTTATTTAGAAGGCATGGGGGG - Intronic
1109350508 13:61174477-61174499 TGATAAGAAGAAAGCTTAGGTGG + Intergenic
1111107180 13:83661933-83661955 TGTTCTTAAGGAAGTGTGGGAGG + Intergenic
1111127136 13:83924993-83925015 TTTTATGAAGAAAACTTGGATGG - Intergenic
1111856393 13:93642872-93642894 TGTTATGAAGAAAGCATGAAAGG + Intronic
1115621981 14:35149692-35149714 TGATATGAAGAAAGTTTTGGTGG - Intronic
1116380842 14:44265950-44265972 TGTTAATAAGAAGACTTAGGAGG + Intergenic
1117574401 14:57083557-57083579 TGTTATTATGAAAGGCTGAGAGG + Intergenic
1119321186 14:73731503-73731525 TCTTGTCAAGAAAGTTTGGGGGG - Intronic
1120278237 14:82405724-82405746 TGATATTAAGAAAGCCACGGTGG + Intergenic
1120521680 14:85533099-85533121 TGGTTTAAAGAATGCTTGGGAGG - Intronic
1122068829 14:99192297-99192319 TGTTATTAGGGAAGCGTGGCTGG - Intronic
1125252738 15:37724557-37724579 TGATATGAAGAAAGCTTTAGTGG - Intergenic
1126268482 15:46783260-46783282 TGGTAATAAGAAAGCTAGGAGGG - Intergenic
1126439325 15:48670800-48670822 TGGTATTCAGAAATCTAGGGTGG + Intergenic
1126527222 15:49669390-49669412 CCTTATTAAGAAAGGTTGGTTGG + Intergenic
1128173931 15:65537008-65537030 TGATATGAAGAAAGTTTGAGTGG + Intronic
1128205996 15:65852520-65852542 TGTTTTTTAGAAAGCTGAGGTGG - Intronic
1128690083 15:69717749-69717771 TGATATGGAGAAAGTTTGGGTGG - Intergenic
1129111744 15:73341036-73341058 TGTTACTAAGACAACTTGGTGGG + Intronic
1130408121 15:83621110-83621132 TGATATGAAGAAAGTTTGAGTGG - Intergenic
1131325930 15:91445140-91445162 TGTGATTAAGAGAGGTTAGGGGG + Intergenic
1133134582 16:3701126-3701148 TGTGTTTAAGAAAGCTGGAGTGG + Intronic
1135473994 16:22757365-22757387 TGTTCATTATAAAGCTTGGGAGG - Intergenic
1138902444 16:61289537-61289559 TTTTGTTAAGAAAGCTTGGTAGG + Intergenic
1140421948 16:74826551-74826573 TGTTATTAAGAAATCAGGTGTGG + Intergenic
1142468883 17:151552-151574 TGATTTTAAAAAAGTTTGGGGGG + Intronic
1146578778 17:34017674-34017696 TGATATTCAGAAAGTTTTGGTGG + Intronic
1148622698 17:49046209-49046231 TGCCATCAAGAAAGCATGGGTGG - Intronic
1149390164 17:56181295-56181317 TTTTTTTAAAAAAGCTTTGGGGG - Intronic
1149400786 17:56293914-56293936 TATTAAGAAGAAAGCTTGTGGGG - Intronic
1149611235 17:57959024-57959046 TGTTATTAATAAAACTTGGCTGG - Intergenic
1151949322 17:77341027-77341049 TGATATGAAGAAAGTTTGAGTGG - Intronic
1152011421 17:77721072-77721094 TTTTATTGAGAAAGACTGGGAGG + Intergenic
1155713140 18:28907205-28907227 TATTATTAAGAAATCTAGGCTGG + Intergenic
1157171197 18:45407437-45407459 TGATATGAAGAAAGTTTGAGAGG - Intronic
1160166131 18:76514060-76514082 TGATATGGAGAAAGCTTGAGTGG - Intergenic
1161745052 19:6052184-6052206 TGATCTTAAGAAAGCTGGAGCGG + Intronic
1163024100 19:14499781-14499803 TTATATTAAGAATGCTTGGCTGG + Intergenic
1164427897 19:28158924-28158946 AGTTATTTAGAAAGCTGAGGTGG - Intergenic
1164829101 19:31307073-31307095 TGTTATTTACAAGGCTTTGGTGG - Intronic
1165991406 19:39816757-39816779 AGTTATAAAGAAAGCAAGGGGGG + Intergenic
1167908123 19:52679022-52679044 TCTTATTAAGGGAGCTTGTGAGG - Intronic
925299782 2:2803485-2803507 TGTTATTGAGAAAGTTTGAGTGG - Intergenic
928818930 2:35336727-35336749 TGATATGAAGAAAGTTTGAGTGG + Intergenic
929229276 2:39542443-39542465 TGTTATCAAGATAGCATGTGAGG + Intergenic
930468540 2:51784082-51784104 TATTATTATGTAAGCTTGCGTGG - Intergenic
930518990 2:52439623-52439645 TGTTCTAAAGAAATCTTGGTAGG - Intergenic
930685820 2:54307011-54307033 TCTTATGAAGAAAGCTGGGAAGG - Intergenic
937382644 2:121394583-121394605 TTTTATTAAAAAATCTTGGCTGG + Intronic
938946944 2:136221278-136221300 TGATGTGAAGAAAGTTTGGGTGG + Intergenic
939509174 2:143085497-143085519 TGACATGAAGAAAGTTTGGGAGG + Intergenic
939517002 2:143181746-143181768 TGCTATGAAGAAAGTTTGAGTGG - Intronic
940328710 2:152452540-152452562 TGTTTTTAAGAAAACTAGGGGGG - Intronic
941259989 2:163285553-163285575 TGATATAAAGAAAGTTTGAGTGG - Intergenic
941881365 2:170483640-170483662 TGTTTTAAAGAATCCTTGGGAGG - Intronic
944517667 2:200528499-200528521 TGTCATTAAGTGAGCTAGGGAGG + Intronic
1169304904 20:4481287-4481309 TGTTGTTAAGAAAGATTCTGAGG + Intergenic
1170287253 20:14723540-14723562 TGTTTCTTAGAAAGCTTGGCTGG + Intronic
1170620585 20:17992418-17992440 TGTTACTACGAAAGCATAGGAGG + Intronic
1171064585 20:22002111-22002133 TGTGAGTAAGAAAGCCTGGATGG + Intergenic
1177330768 21:19658269-19658291 TAATATTAACAAAGTTTGGGGGG + Intergenic
1177633483 21:23756329-23756351 TGTGATTATGAAATCTTGGCCGG - Intergenic
1181842108 22:25672499-25672521 TGTTTATAAGGAAGCATGGGAGG - Intronic
1181957678 22:26599899-26599921 TTTTATTAAGAGTGCTGGGGGGG + Intronic
1184017620 22:41798196-41798218 TGTTCTTAAGAAAGCTTGGATGG + Intronic
1184017625 22:41798274-41798296 TGTTCTTAAGAAAGCTTGGATGG + Intronic
951353821 3:21640184-21640206 TGTGAATTAGAAAGCTTGAGAGG - Intronic
955263502 3:57418843-57418865 TGTTATTAAGAAAGTTGGTATGG + Intronic
956117299 3:65931332-65931354 GTTTATTAAGAAAGCAAGGGAGG - Intronic
959996544 3:112686782-112686804 AGTTATTATGAACACTTGGGTGG + Intergenic
960350032 3:116581113-116581135 TGTAATTAAGAAAGGGTAGGAGG + Intronic
962663564 3:137630324-137630346 TGATATGAAGAAAGTTTGAGTGG - Intergenic
963687351 3:148453733-148453755 CGTTTATAAGAAAGCTTGGAAGG + Intergenic
965235082 3:166108294-166108316 TGTTTTTAAGAAACTTTGAGAGG - Intergenic
965554069 3:170001691-170001713 TGTTAATAAGAAACTTTGGGTGG - Intergenic
969434834 4:7182875-7182897 TGCTATCAGGGAAGCTTGGGAGG - Intergenic
970751037 4:19361851-19361873 TGATATGAAGAAAGTTTGAGTGG + Intergenic
971431589 4:26573673-26573695 TCTGTTTAAGAAAGCTAGGGTGG + Intergenic
974835448 4:67243243-67243265 TCTTATTTAGAAAGCAGGGGTGG + Intergenic
977072014 4:92403199-92403221 TGATATGAAGAAAGTTTGGGTGG - Intronic
978623945 4:110663416-110663438 TGTTATTGAAAAAGCAAGGGGGG + Intergenic
978633004 4:110768812-110768834 TCTTTTGAAGAAATCTTGGGAGG - Intergenic
979271837 4:118771726-118771748 TGGTATTAAGAAGGCATTGGTGG - Intronic
979958765 4:126990191-126990213 TGTGACTAAGAAAGCTGGGATGG - Intergenic
980641092 4:135580962-135580984 TGTTCATAAGAAAGGTTGGTTGG - Intergenic
980675405 4:136072586-136072608 AGTAATTAAGAAAGTTTGGGTGG + Intergenic
982570077 4:157038358-157038380 TTTTTTTAAGAAAGCTTGCCAGG - Intergenic
983116674 4:163826288-163826310 AGTTATTAAGATACCTTTGGAGG + Intronic
984035713 4:174665014-174665036 TGTTGTAAAGAAAATTTGGGAGG + Intronic
986803561 5:11285922-11285944 TGTTAATAAGAGAGCATAGGTGG + Intronic
987736337 5:21848282-21848304 TGTTTTTAATAAAGATTTGGAGG + Intronic
987867337 5:23562086-23562108 TGCTAGAAAGAAAGCTTGAGGGG - Intergenic
988616043 5:32775852-32775874 TGTTATTAAGAAAGCTTGGGAGG - Intronic
989464638 5:41740638-41740660 TGTTTTGAAGAATTCTTGGGTGG - Intronic
990861857 5:60336123-60336145 TGTTTTAAAGCAAGCTTGGCAGG - Intronic
991468511 5:66941566-66941588 TGATATGAAGAAAGTTTTGGTGG - Intronic
992231175 5:74665584-74665606 TCTCATTAAGAAAGCTTAGCTGG - Intronic
994070759 5:95599373-95599395 AGTCTTTAAGAAAGGTTGGGAGG - Intronic
994851443 5:105058812-105058834 TGATATGGAGAAAGCTTGAGTGG + Intergenic
996532068 5:124536567-124536589 GGTTATGAAGAATGCTTTGGTGG - Intergenic
996532243 5:124538337-124538359 GGTTATGAAGAATGCTTTGGTGG - Intergenic
997315139 5:132926894-132926916 AGGTATTAAGAAAGCTTTGAAGG - Intronic
998989261 5:147797366-147797388 TATTATGAAGAAAGTTTGAGTGG + Intergenic
999073610 5:148773970-148773992 TGCTATCAAGACAGCTGGGGTGG - Intergenic
999863399 5:155673924-155673946 TGGGATTCAGAAAGCTTAGGTGG + Intergenic
999897124 5:156047020-156047042 TGGTATGAAGAAAGTTTGAGTGG + Intronic
1000560811 5:162786703-162786725 TGTTCTTAAGAAACCTTGTTAGG + Intergenic
1000912118 5:167034982-167035004 TGTTTTTAAGATAGGTTGAGGGG + Intergenic
1001347407 5:170917528-170917550 GGTTATTAATAAATTTTGGGGGG + Intronic
1001504716 5:172269190-172269212 TGTCATTTAAAAAGTTTGGGCGG + Intronic
1003167665 6:3695372-3695394 TGTTATTAAGAAAATAAGGGTGG - Intergenic
1003996155 6:11541560-11541582 TGATATGAAGAAAGTTTGAGTGG - Intronic
1004881865 6:20016514-20016536 TATTATTAAGAAAACTTCAGTGG + Intergenic
1004972316 6:20924183-20924205 TGATATGAAGAAAGTTTGAGTGG + Intronic
1004972353 6:20924538-20924560 TGATATGAAGAAAGTTTGAGTGG + Intronic
1005765423 6:29006509-29006531 TGTTAGTAAGAATCCTTAGGTGG + Intergenic
1007054953 6:38873883-38873905 TGCAATCAAGAAAACTTGGGAGG + Intronic
1007865120 6:44959977-44959999 TTTTATTATGAAACCTTGGTGGG - Intronic
1009315249 6:62210885-62210907 TATTATTAAGAAAGCTTCACTGG - Intronic
1012824725 6:104132934-104132956 TGATATGGAGAAAGCTTGAGTGG + Intergenic
1015496075 6:133884650-133884672 TCTTTTTGTGAAAGCTTGGGAGG + Intergenic
1016925945 6:149348274-149348296 TGCTACTAAGGAAGCTGGGGAGG + Intronic
1016933331 6:149429911-149429933 TTTTTTAAAGAAAGTTTGGGGGG + Intergenic
1017461004 6:154650326-154650348 TGTTATGAAGAAAGTTTGAGTGG - Intergenic
1018076567 6:160221401-160221423 TGATATGGAGAAAGCTTGAGTGG - Intronic
1018637370 6:165875073-165875095 AGTTATTAAGAAAGGTTTGGGGG + Intronic
1019125217 6:169834481-169834503 TGATAATAAAAAAGCTTCGGTGG + Intergenic
1021030243 7:15724043-15724065 AGTTATTAAGAACACATGGGAGG - Intergenic
1021867774 7:24976304-24976326 TGTTGTTAAAAATTCTTGGGTGG - Intronic
1022035687 7:26531980-26532002 AGTAATAAAGTAAGCTTGGGGGG + Intergenic
1023474583 7:40563122-40563144 TGCTGCTAAGAAAGCATGGGAGG - Intronic
1024938227 7:54734432-54734454 TGTTATGCAGAAAGCTTGGCTGG - Intergenic
1025974338 7:66357707-66357729 TGATCTTAAGAAAGTTTGGGTGG - Intronic
1027538790 7:79441211-79441233 TGATACTAAGAAAGTTGGGGAGG + Intronic
1028178282 7:87683246-87683268 TGATATGAAGAAAGTTTGAGTGG - Intronic
1030863098 7:114661839-114661861 TATTATTAAAATAGCTTGGAAGG + Intronic
1031627245 7:124005088-124005110 TGTCAGTTAGAGAGCTTGGGTGG + Intergenic
1031630547 7:124038076-124038098 TCTTAATAAGAAAGGTTGGCCGG - Intergenic
1033795309 7:144838672-144838694 TGCTATGAAGAAAGTTTGAGTGG + Intergenic
1038130378 8:24723867-24723889 TGATATGAAGAAAGTTTTGGCGG + Intergenic
1039033730 8:33336606-33336628 AGGTATTCAGAAAGCCTGGGAGG + Intergenic
1040522670 8:48191871-48191893 TCTTATAAAAAAGGCTTGGGAGG - Intergenic
1043160570 8:76841365-76841387 CGTTATTAATAAAACATGGGGGG + Intronic
1043204211 8:77415883-77415905 TGATATAAAGAAAGTTTGAGTGG + Intergenic
1045910523 8:107402469-107402491 AGTTACTAAGATAGCATGGGAGG + Intronic
1046739095 8:117809684-117809706 CGACATTAAGAAAGCTTGGTAGG + Intronic
1046848988 8:118951989-118952011 TCTTTTTTAGGAAGCTTGGGCGG + Exonic
1046902229 8:119535818-119535840 TGTAACTGAGAAAACTTGGGAGG + Intergenic
1047957862 8:129989069-129989091 AGTTATTAATAAATGTTGGGGGG - Intronic
1050170539 9:2811266-2811288 TGTCAGTAAGAAAGCTGGGGAGG - Intronic
1050349564 9:4727612-4727634 TGATATGGAGAAAGCTTGAGTGG - Intronic
1052423279 9:28271789-28271811 TTTGAGTAAGAAAGCTTTGGAGG - Intronic
1055297084 9:74844649-74844671 TGATATGAAGAAAGTTTGAGTGG - Intronic
1055653639 9:78432625-78432647 TGTTTTAAAGGAGGCTTGGGTGG - Intergenic
1056310500 9:85335997-85336019 AGTTTTGAAGAAAGCTGGGGAGG - Intergenic
1057610299 9:96536987-96537009 TGTTTTTAAGAAATTTTGTGTGG + Intronic
1057957155 9:99419638-99419660 TGTTGATGAGAAGGCTTGGGTGG + Intergenic
1058987210 9:110219417-110219439 TGTTTTTTAGGAAGCTTGTGAGG - Intergenic
1060208115 9:121694354-121694376 TGTTATCAGGAATCCTTGGGAGG - Intronic
1061020652 9:128012295-128012317 TTTTATTAAGAAACCATGGCGGG + Intergenic
1186019751 X:5240745-5240767 GGTTATTAATAAAGTTTTGGAGG - Intergenic
1189819292 X:44855100-44855122 TGTAATTACGGCAGCTTGGGAGG - Intergenic
1192667633 X:73104408-73104430 TGTTATGAAGAAAGTTTTAGTGG + Intergenic
1194160974 X:90452032-90452054 TTTTATTAAGAAATATTGGCTGG + Intergenic
1194550267 X:95289730-95289752 TTTTATTTAGAAAGCTTTGTTGG + Intergenic
1194945988 X:100068120-100068142 TGACATTAATAAAACTTGGGTGG + Intergenic
1194960363 X:100228260-100228282 TCTTATAAAGAAAGGTTGGAAGG - Intergenic
1194985926 X:100489761-100489783 CTTTCTTAAGAAAGGTTGGGAGG + Intergenic
1198766975 X:140090697-140090719 TGTCATTAAGAAAAATGGGGTGG - Intergenic
1199429986 X:147747828-147747850 TGTTATCAAGGGAGATTGGGTGG - Intergenic
1200507264 Y:4028967-4028989 TTTTATTAAGAAATATTGGCTGG + Intergenic