ID: 988617315

View in Genome Browser
Species Human (GRCh38)
Location 5:32787460-32787482
Sequence AAGTTGTTCTTGAGGGAAAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 339}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988617315 Original CRISPR AAGTTGTTCTTGAGGGAAAA GGG (reversed) Exonic
902396203 1:16133599-16133621 CAGTTGTTCTGGAAGGAGAAGGG + Exonic
902624042 1:17666639-17666661 CAGCTGTTCTTGGGGGAGAAAGG - Intronic
903199317 1:21720833-21720855 AAATTGTTTTTTAGGGAAACAGG + Intronic
906820041 1:48919775-48919797 AAATGTTTCTTGAGGAAAAAGGG + Intronic
907660720 1:56390295-56390317 AAGTTCTTCTGGAGAGGAAAAGG + Intergenic
907876989 1:58500109-58500131 AAATTGCTTTTGAGGGGAAAGGG - Intronic
908813728 1:68010594-68010616 ACGTATTTATTGAGGGAAAAAGG - Intergenic
909046771 1:70720283-70720305 CAGTTGGTCTCAAGGGAAAAGGG - Intergenic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
909595243 1:77399353-77399375 AGGTTGTGGTTGAGAGAAAAGGG - Intronic
910664339 1:89708187-89708209 GAGTTGTCCTTGAAAGAAAATGG + Intronic
910971825 1:92863697-92863719 AAGTTGGTATAAAGGGAAAAGGG + Intronic
911844785 1:102738081-102738103 AAGTTATACTTGGAGGAAAAGGG - Intergenic
912091140 1:106078097-106078119 AAGGTGTTCTGGAGGAAAGATGG + Intergenic
913216077 1:116621460-116621482 AAGATGTTGTTGGGGGGAAAGGG - Intronic
913297966 1:117340106-117340128 CCTCTGTTCTTGAGGGAAAATGG + Intergenic
913535966 1:119772663-119772685 AAGTTGTTCCTTTGGGATAAGGG + Intergenic
915003008 1:152610788-152610810 AAGTTATTCTTAAGGAAAATGGG - Intergenic
916560958 1:165933866-165933888 AAGATGTGCTTGAGAGAAAAGGG - Intergenic
917312313 1:173690459-173690481 TATTTGTTTTTAAGGGAAAAAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918407609 1:184226190-184226212 AGGTTTTTGTTGAGCGAAAAGGG - Intergenic
919159505 1:193809599-193809621 AGTTTGTTTTTGAGGGAATAGGG + Intergenic
920454542 1:206089002-206089024 AAAGTATTCTTGAGGGAAACAGG - Intronic
920814598 1:209319515-209319537 AAGTTTTTCTTGTGGCAAATTGG + Intergenic
921699651 1:218253815-218253837 AATTTCTTCTTAAGGGAAATTGG + Intergenic
921764105 1:218950448-218950470 AAGGGGGTCTTAAGGGAAAAAGG - Intergenic
922033670 1:221827664-221827686 AAGTTGTTGATGAAGGAAACTGG + Intergenic
922572108 1:226640305-226640327 AATCTGTTCTTTAGGGACAAAGG + Intronic
923449798 1:234105914-234105936 ATATTGTAGTTGAGGGAAAAGGG - Intronic
923752342 1:236757469-236757491 AATGTGCTATTGAGGGAAAAGGG - Exonic
924648335 1:245901013-245901035 AAGTTCTTCTTAAGGCAAAATGG + Intronic
1062989422 10:1802068-1802090 AAATGGTACCTGAGGGAAAAAGG + Intergenic
1063323839 10:5077427-5077449 ATGATGTTCTTGTGGGAAACTGG + Intronic
1063524273 10:6769981-6770003 AAATTGTTCATGAGCGAAAAGGG + Intergenic
1063895965 10:10682350-10682372 AAATTGTTCTTTAAGAAAAACGG - Intergenic
1064000070 10:11656315-11656337 AAGTTCTTTCTGTGGGAAAAGGG + Intergenic
1064234602 10:13562600-13562622 AAGTTGCTGCTGAGGGAGAAGGG + Intergenic
1064331697 10:14400395-14400417 GAATTGTCATTGAGGGAAAAGGG - Intronic
1066228887 10:33412526-33412548 AAGTACTGCTTGAAGGAAAAAGG + Intergenic
1069390933 10:67934277-67934299 AAGTTCTTTTTAAGAGAAAAAGG - Intronic
1070568511 10:77622131-77622153 TAGTTTTTCTTGCTGGAAAATGG - Intronic
1071283615 10:84124873-84124895 AATTTGTTTTTAAGGGAAAAAGG + Intergenic
1072019778 10:91386918-91386940 AAGCTGCTCTTGAGGTAAAGTGG - Intergenic
1072823408 10:98581365-98581387 AAGTTGTTGTTAAGTTAAAATGG - Intronic
1073594745 10:104788553-104788575 AAGCTGTTGTTGAGGGAAAGGGG + Intronic
1074856028 10:117474254-117474276 AAGTTGTTCTTCTGAGAAAGAGG + Intergenic
1075206600 10:120454657-120454679 AAGTGGTTTTGGAGGGCAAAAGG - Intergenic
1075285300 10:121179938-121179960 AAGTTATTTTTGAGGAAAAAAGG - Intergenic
1076579981 10:131500914-131500936 AAGTAGCTCTTGAGAAAAAAAGG + Intergenic
1077671371 11:4160859-4160881 AAGTAGATCTGGAGGGACAAAGG - Intergenic
1078080004 11:8197283-8197305 AAGTTGTTATTGATAGAGAAGGG - Intergenic
1078621525 11:12913037-12913059 AGGTTTTTCTTGAGGTGAAATGG - Intronic
1079137913 11:17786708-17786730 CATTTGTTCATGTGGGAAAATGG - Intergenic
1080593114 11:33740757-33740779 TAACTGTTCTTGGGGGAAAATGG + Intergenic
1083263794 11:61536937-61536959 AAGCTTTTCATGAGGGAAACAGG - Intronic
1083547576 11:63560382-63560404 AAGTTGCTCTTCAGGGGACAAGG + Intronic
1083904723 11:65662377-65662399 ACCTGCTTCTTGAGGGAAAACGG + Intronic
1083917624 11:65759311-65759333 ATGTTATTGTTGAGGGAAACAGG - Intergenic
1087970594 11:104476950-104476972 AAATTGTCCTTGAAGAAAAATGG + Intergenic
1088140072 11:106605243-106605265 AAGTTGCCCTTGAGGGCACAGGG - Intergenic
1088419848 11:109634160-109634182 AAGTTGTTCTTCAGAAATAAAGG - Intergenic
1088959378 11:114647348-114647370 AAGTTGTTCTAGAAAGTAAAGGG - Intergenic
1089791363 11:120946970-120946992 AAGTTGGTATGGAGGGAAAATGG - Intronic
1090005536 11:122999048-122999070 AATTTGTTCTTAAGGGATAAGGG - Intergenic
1090324214 11:125870814-125870836 TAGTTGTTTTTAAGGAAAAAAGG + Intergenic
1090337343 11:125980761-125980783 AAGTTGTTCTTTAGATGAAATGG - Intronic
1091526918 12:1312000-1312022 ATCATGTTCTTGAGGAAAAATGG - Intronic
1092104167 12:5909247-5909269 AAGTACTTGTTGAGGGCAAAAGG - Intronic
1093687199 12:22070500-22070522 AAGTTCTTTGTGAGGGAGAAGGG - Intronic
1093828860 12:23730448-23730470 GACATGTTCTTGAGGGAAGATGG + Intronic
1095236897 12:39807423-39807445 AAGTTGTTATTCAGGGGAACTGG + Intronic
1096432523 12:51558658-51558680 ATGTAGTTCTTGTGAGAAAATGG - Intergenic
1096868846 12:54580799-54580821 AAGTTATTCTTTATGGTAAAAGG - Intronic
1097396763 12:59084695-59084717 AAATTGTTCTTCAGGAAAGATGG - Intergenic
1097884967 12:64719950-64719972 ATGCTGTTCTTGAAGGCAAAGGG - Intronic
1098052699 12:66471131-66471153 AAGTGGCTCTGGAGGTAAAAAGG + Intronic
1099228857 12:80000328-80000350 TAGTGGTACTTGATGGAAAAGGG - Intergenic
1099543629 12:83947842-83947864 ATGTTGTTCTTAGGGGAAGAAGG + Intergenic
1099684565 12:85868172-85868194 AAGTTGTCCTTGAGGAAAACTGG - Intergenic
1100082970 12:90875618-90875640 AAGCTGTTCTTCTGGCAAAAAGG - Intergenic
1100715202 12:97298348-97298370 CAGCTGTTCTGGAGGGAATATGG + Intergenic
1102844432 12:116163977-116163999 ATGTTCTTCTTGGGAGAAAAAGG + Intronic
1104039475 12:125120369-125120391 AATCTGTTCTTGGGGGAAACAGG + Intronic
1104161109 12:126181892-126181914 AAATTGATCTTGAAGGCAAATGG - Intergenic
1105219809 13:18314937-18314959 AAGATGTTGTTGGGGGGAAAGGG - Intergenic
1106703850 13:32259382-32259404 AAGCTGTTCTTGGAGGAATAAGG - Intronic
1107347739 13:39480656-39480678 AAGTTTTTCTTGAGTAAAAAAGG - Intronic
1109159582 13:58955925-58955947 AATTATTTCTGGAGGGAAAAAGG + Intergenic
1109241048 13:59888723-59888745 AAGTTGTCCTTCAGGCAAAAGGG - Intronic
1109590886 13:64479898-64479920 AAATTGTTTTTGAAAGAAAATGG + Intergenic
1109796895 13:67326992-67327014 AAGTTGTTATTAGAGGAAAATGG - Intergenic
1110326573 13:74223145-74223167 AGGATGTTCTGGATGGAAAACGG + Intergenic
1110360547 13:74620370-74620392 AAGTTTAGCTTGGGGGAAAAGGG - Intergenic
1111152562 13:84275416-84275438 AAATATTTCTTGAGGGAGAAGGG - Intergenic
1113616193 13:111682297-111682319 AAGATGTTCTAAAGGAAAAATGG + Intergenic
1113621661 13:111767190-111767212 AAGATGTTCTAAAGGAAAAATGG + Intergenic
1114537900 14:23434418-23434440 AACTAGTTCTTGAGGAAAAAGGG - Intronic
1117830172 14:59742215-59742237 CATTTCTTCTTGAGGGAAACTGG + Intronic
1117987369 14:61400774-61400796 AATTTGTTATAGAGAGAAAATGG - Intronic
1118196256 14:63629486-63629508 AAACTGTTCCTGAGGGAGAAAGG - Intronic
1118657017 14:67962601-67962623 AAGTTGTTGTTGAGGTATAAAGG + Intronic
1118862221 14:69673331-69673353 AAGTTCTTCTTTAGGGAACTTGG - Intronic
1119759957 14:77143264-77143286 AAGCTGCTCTGAAGGGAAAAGGG - Intronic
1120510522 14:85408231-85408253 ATGTTATTCTAGAGGAAAAATGG + Intergenic
1120718659 14:87867343-87867365 AAAATGTCCATGAGGGAAAATGG + Intronic
1125138008 15:36366794-36366816 AACATATTCTTGAGGGAAAGGGG - Intergenic
1126217246 15:46170265-46170287 AATTTGTTCTTGATGGCACAAGG - Intergenic
1126860396 15:52877377-52877399 AATTTGTTCCTTAAGGAAAAGGG - Intergenic
1127230987 15:56994814-56994836 AAGATGTTCTTAAGACAAAAGGG + Intronic
1127330327 15:57932704-57932726 AAGATGGTCATGTGGGAAAAAGG - Intergenic
1128147942 15:65343189-65343211 TATCTGTTCTTGAGGGAAGATGG + Intronic
1128928578 15:71681812-71681834 AAGATGTTCATGGGGGCAAACGG + Intronic
1130356556 15:83136827-83136849 AAATTTTTTTTGAAGGAAAATGG + Exonic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1132151382 15:99462475-99462497 AAGGTGTTCATGAGGAAAACTGG + Intergenic
1133367785 16:5224617-5224639 CAGTCGTTCCTGAGGGCAAAGGG + Intergenic
1134041066 16:11068665-11068687 AAGTTGAGCTTGAGAGAAAGAGG - Intronic
1135777091 16:25266330-25266352 AAATTTTTCTTTAGGAAAAATGG - Intergenic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1137728425 16:50672543-50672565 AGGCTGTTCTTGAGGGCAATAGG + Exonic
1137968843 16:52963514-52963536 AAAGTGTTCTTTAGGGGAAAAGG - Intergenic
1138218625 16:55228309-55228331 AAGTAGTTATTGAGTCAAAAGGG + Intergenic
1139049558 16:63107144-63107166 AAGTCCTTCTTGAAAGAAAATGG - Intergenic
1139752593 16:69118828-69118850 AGGTGGTCCTGGAGGGAAAATGG + Exonic
1141401678 16:83753179-83753201 AAGTTTTTGGTGAGGCAAAAAGG - Intronic
1143197600 17:5087941-5087963 AAGAAGATCTAGAGGGAAAATGG + Intronic
1144068436 17:11645335-11645357 AAGTTATTTTAGAGGTAAAAGGG - Intronic
1148914468 17:50963379-50963401 AACTTGTTATTGGGGGAAAGGGG + Exonic
1149089919 17:52765149-52765171 TGGTTGTTCCTGAGGGAGAAGGG + Intergenic
1149929752 17:60739723-60739745 AAGAAGTTCTACAGGGAAAAAGG - Intronic
1150927931 17:69553788-69553810 AAAGTGTTCTTGAAAGAAAATGG + Intergenic
1150995849 17:70316427-70316449 AAGCTTTTCTGGAGGGAAATGGG - Intergenic
1153826742 18:8882070-8882092 TATTTGTTTTTAAGGGAAAAAGG + Intergenic
1155762500 18:29585538-29585560 AAGTTGTTCTTCAGAAATAAAGG + Intergenic
1156222694 18:35069159-35069181 AAGTTGTTGTTGAAGGAACTAGG - Intronic
1156579105 18:38354828-38354850 GAGTAGTTGTTGAGGGAGAAGGG + Intergenic
1157555265 18:48609330-48609352 AGGTGGGCCTTGAGGGAAAAGGG + Intronic
1159251480 18:65883686-65883708 AACTTGTTCTCCAGAGAAAAGGG - Exonic
1162268536 19:9595622-9595644 TATTTGTTTTTAAGGGAAAAAGG + Intergenic
1162563716 19:11433412-11433434 CAGTGGTTCTTGTTGGAAAAGGG - Intronic
1165605273 19:37097688-37097710 AAGTTCTTTATGTGGGAAAATGG + Intronic
1166576399 19:43842867-43842889 AAGATGTTCTTAAGTGAAAATGG - Intronic
925726236 2:6875295-6875317 TAGTTTTGCTTGAGGGAAGAGGG - Intronic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927809921 2:26175186-26175208 AAGTTGTGCCTGAAGGAGAAAGG + Intronic
928246864 2:29638083-29638105 AAGGTGTGCTTTAGGGAAAACGG - Intronic
928843449 2:35638881-35638903 AATGCATTCTTGAGGGAAAAAGG - Intergenic
929441477 2:41968601-41968623 AATTTGTCCTAGAGGGAAGAGGG - Intergenic
929450671 2:42034964-42034986 AAGCTGCCCTTGAGGGAAAGTGG + Intergenic
930399026 2:50859532-50859554 AAGTCTTTTTTGAGGGGAAAAGG + Intronic
930590409 2:53320284-53320306 AAGTTTTTCTTGGAGCAAAAAGG - Intergenic
930744698 2:54870284-54870306 AAGTTGTATTTGGGGGAAAAAGG + Intronic
930960783 2:57259047-57259069 AAGATGTTACTGATGGAAAATGG + Intergenic
931483151 2:62663362-62663384 AAACTGTTCTTGATGCAAAAAGG + Intergenic
932066085 2:68562308-68562330 AACATGTTTTTGAAGGAAAAAGG + Intronic
932231825 2:70089444-70089466 AAGGTTTTCTCGAGGGGAAAAGG + Intergenic
932514937 2:72336108-72336130 GAGTTGTTTTTGAGGTAAATAGG - Intronic
933390143 2:81657235-81657257 TATTTGTTTTTAAGGGAAAAAGG + Intergenic
934117354 2:88810152-88810174 AAGTTGTTTGTGTGGTAAAAAGG - Intergenic
934123250 2:88860941-88860963 AGGTTTTTGTTGAGGGGAAAGGG - Intergenic
934184238 2:89657580-89657602 AAGATGTTGTTGGGGGGAAAGGG + Intergenic
934294527 2:91731718-91731740 AAGATGTTGTTGGGGGGAAAGGG + Intergenic
938663848 2:133513501-133513523 GAGTGGATCTGGAGGGAAAATGG + Intronic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
939663237 2:144917104-144917126 ACCTTGTTCTTGAGAGAAGAAGG - Intergenic
939867994 2:147496053-147496075 ATGTTGTTTTTTAGGGAAAATGG + Intergenic
941410100 2:165143888-165143910 AAGATGTTCTAGTGGGAACAAGG + Intronic
941571945 2:167181628-167181650 TATTTGTTCTGGAGGAAAAAAGG - Intronic
942225678 2:173813346-173813368 ATGTTGATCTTAAAGGAAAAGGG + Intergenic
946837547 2:223787432-223787454 AAGGTGTTCTTGAGTTAAGAAGG + Intronic
1169106240 20:2997507-2997529 ATGTTGTTCTGGAGAGAAACTGG + Intronic
1169460249 20:5788404-5788426 AAGTTGAGTTTGAGGAAAAATGG + Intronic
1170745352 20:19093872-19093894 AAGTTGATCTGGTGGGAGAAGGG - Intergenic
1171496339 20:25558597-25558619 AAGTTGGTCAAGAAGGAAAAAGG - Intronic
1173264051 20:41461707-41461729 AAGTTGTTCTTGGGGGCAGGAGG + Intronic
1173405054 20:42757259-42757281 GAGTTCTGCTTAAGGGAAAAAGG - Intronic
1174779249 20:53373076-53373098 AACTTGTTCTTGTGAGAAAATGG + Intronic
1177129241 21:17236415-17236437 AAATTGATCTGAAGGGAAAATGG - Intergenic
1178027154 21:28481000-28481022 AACTTGTTTTTAAGGAAAAAAGG - Intergenic
1180237176 21:46469804-46469826 AAAATGCCCTTGAGGGAAAATGG - Intronic
1180817415 22:18799828-18799850 AAGATGTTGTTGGGGGGAAAGGG - Intergenic
1181203605 22:21234149-21234171 AAGATGTTGTTGGGGGGAAAGGG - Intergenic
1181950602 22:26550931-26550953 GAGTGGTTCAAGAGGGAAAAAGG + Intronic
1182991949 22:34776604-34776626 AAGGTGATCTGGAGGGAAATTGG + Intergenic
1184888590 22:47365525-47365547 AAGTTGTTCTTCAGAAATAAAGG - Intergenic
1184992109 22:48177697-48177719 ATGTTGTTGTTGAGGGATGAAGG - Intergenic
1203223316 22_KI270731v1_random:61266-61288 AAGATGTTGTTGGGGGGAAAGGG + Intergenic
1203267513 22_KI270734v1_random:25554-25576 AAGATGTTGTTGGGGGGAAAGGG - Intergenic
949887701 3:8709569-8709591 AAGTTGTACTTGGGGCAGAAGGG + Intronic
950065959 3:10111938-10111960 ATGCTGTTCTTGAGTGAAGATGG - Intergenic
950846801 3:16022889-16022911 TATTTGTTTTTAAGGGAAAAAGG + Intergenic
952011034 3:28901689-28901711 TAGCTGACCTTGAGGGAAAATGG - Intergenic
952799235 3:37272663-37272685 AACTTATTCTTAAGTGAAAAAGG - Intronic
954659238 3:52218044-52218066 AAGGTGTCCTAAAGGGAAAAGGG + Intergenic
954964411 3:54597587-54597609 AAAATGGTCTTGAGGGTAAAAGG + Intronic
955444301 3:58992948-58992970 AATTTGTTTTTGAGGGACAGGGG - Intronic
955597040 3:60602423-60602445 AAGTTGTTATTCAGGTATAAAGG + Intronic
955871047 3:63438823-63438845 AAATTGTTCCTGAAGCAAAATGG + Intronic
955878783 3:63522015-63522037 AAGTAGATCTGGAGGGACAAAGG + Intronic
956896792 3:73668997-73669019 CAGGTGTTCTTAAAGGAAAATGG - Intergenic
956963523 3:74431719-74431741 TAGTTCTTTTAGAGGGAAAATGG - Intronic
958044533 3:88267366-88267388 CAGGTGCTCTTGAGAGAAAAGGG + Intergenic
958947826 3:100383722-100383744 AAGTTATTATTAAAGGAAAAAGG + Intronic
959853812 3:111123770-111123792 AAGTTGTACTTCAGGGTGAAGGG - Intronic
960057839 3:113288299-113288321 ACGTTGAGCTTGATGGAAAAAGG - Exonic
961026105 3:123559332-123559354 AAATTTATCTAGAGGGAAAAAGG + Intronic
962710603 3:138082454-138082476 AAGCTGATCTTCAGGGTAAAAGG + Intronic
962783448 3:138743868-138743890 AAGTTGTTCAGGAGTCAAAAGGG - Intronic
963564489 3:146911171-146911193 AAATTGTCTTTGGGGGAAAAGGG + Intergenic
963773549 3:149415287-149415309 AAGTTGTTTTTAAGGGAAATTGG - Intergenic
964060481 3:152516144-152516166 AACCTATTCTTCAGGGAAAAGGG - Intergenic
964588817 3:158337807-158337829 AAGTGGTTCATGAGGGTATAAGG - Intronic
964818828 3:160747531-160747553 TAGTTGTTCTTAAAAGAAAAAGG + Intergenic
964950706 3:162288970-162288992 AAGTAGTTCTAGAGATAAAATGG + Intergenic
965249628 3:166326582-166326604 AATATGTTCTTGAGGGAAATTGG + Intergenic
965422189 3:168474810-168474832 ACTTTCTTCTTGATGGAAAAGGG + Intergenic
965918603 3:173883039-173883061 AAAATGTTCTTGAAGGAAATTGG - Intronic
966268925 3:178081629-178081651 AAGCTGTTTTGGAGGGAGAAAGG - Intergenic
966371221 3:179252479-179252501 AAGATGTTGCTGGGGGAAAAGGG - Intronic
967145965 3:186606361-186606383 CAGATGTTTTTCAGGGAAAATGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
970302389 4:14694943-14694965 AAGTTGATCTTCAGGTTAAAAGG + Intergenic
971197830 4:24486328-24486350 GAGTGGTTCCTGAGGCAAAAAGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972411695 4:38801736-38801758 TAGCTGTTGTTAAGGGAAAAAGG - Intronic
973854893 4:55001479-55001501 AAGTGGATCTTTGGGGAAAAAGG + Intergenic
974539168 4:63211231-63211253 GAGGTCTACTTGAGGGAAAAGGG + Intergenic
974722369 4:65757151-65757173 AAGTAGTTCTTGTGAGAAGAGGG + Intergenic
975554752 4:75650580-75650602 AACTTCATCTTGAGGGAAATAGG - Intronic
976964067 4:91012910-91012932 AACTTCTTCTTGTGGGGAAATGG - Intronic
977380264 4:96263971-96263993 AAGTGGTTCTTGGGAGAAGAAGG + Intergenic
978313828 4:107414552-107414574 TATTTGTTTTTAAGGGAAAAAGG - Intergenic
980119983 4:128717846-128717868 AAGTTGCTCATGTGGGCAAATGG + Intergenic
981781914 4:148440769-148440791 AAGTACTTCTTTATGGAAAAGGG - Intronic
982040610 4:151391869-151391891 AAGTTGTTCCTGAGCAAAAAAGG + Intergenic
983418902 4:167493436-167493458 AAGTTGGTCTTCAGAGTAAAAGG + Intergenic
984379105 4:178967643-178967665 AAGTTGTTTCTACGGGAAAAGGG + Intergenic
984901498 4:184590618-184590640 AAGATGTTCTGTCGGGAAAACGG + Intergenic
986969560 5:13316132-13316154 AAGTTTTGTTTGGGGGAAAAGGG - Intergenic
987704393 5:21444679-21444701 AAGTTGTACTAGAGGGGAAAGGG - Intergenic
987800034 5:22683682-22683704 AATTTCTTCTTTAGCGAAAAAGG - Intronic
988617315 5:32787460-32787482 AAGTTGTTCTTGAGGGAAAAGGG - Exonic
988752697 5:34206757-34206779 GAGTTGTTCTGAGGGGAAAATGG + Intergenic
989363706 5:40632810-40632832 AAGTTGTTATTGAGTAACAAAGG - Intergenic
990014786 5:51046626-51046648 AACTTGTTTTTGAGGGAAGATGG - Intergenic
990206188 5:53432109-53432131 ATGTATTTCTTAAGGGAAAATGG - Intergenic
990660190 5:58005075-58005097 TGGTTGTTGTTGAGGGAAACAGG + Intergenic
990802720 5:59623371-59623393 AGGTTGTTATTGAGGGCAACAGG - Intronic
991115511 5:62950138-62950160 AAGATGTTATTGAGGAAGAAAGG - Intergenic
991630742 5:68654282-68654304 AAATAGTTCTTGAAAGAAAATGG - Intergenic
991740467 5:69667571-69667593 GAGTTGTTCTGAGGGGAAAATGG + Intergenic
991757032 5:69885596-69885618 GAGTTGTTCTGAGGGGAAAATGG - Intergenic
991792042 5:70247312-70247334 GAGTTGTTCTGAGGGGAAAATGG + Intergenic
991819928 5:70543676-70543698 GAGTTGTTCTGAGGGGAAAATGG + Intergenic
991836435 5:70761478-70761500 GAGTTGTTCTGAGGGGAAAATGG - Intergenic
991884489 5:71247638-71247660 GAGTTGTTCTGAGGGGAAAATGG + Intergenic
993893495 5:93503755-93503777 AACTTGTTCCTGAGGGAATTAGG + Intergenic
994509403 5:100684692-100684714 TTGTGGTTCTTGTGGGAAAAAGG - Intergenic
994827807 5:104738124-104738146 ATGCTATTTTTGAGGGAAAATGG + Intergenic
994943855 5:106360056-106360078 AATTTGATCTTGAGAGAAAGAGG - Intergenic
995017633 5:107329384-107329406 AAGTTTTTCTTGATTCAAAAGGG - Intergenic
996826809 5:127692024-127692046 AAATTGTAATTTAGGGAAAAAGG + Intergenic
997397932 5:133579566-133579588 AAGTGGCTCTTGAGAGGAAAGGG + Intronic
997760439 5:136443532-136443554 AGGATGTTCTTCAGGGTAAATGG - Intergenic
997771488 5:136558560-136558582 AAGATGTTGTTGACTGAAAAGGG - Intergenic
998774741 5:145586607-145586629 ATGTTCTTATTGAGGGAATAAGG - Intronic
999915202 5:156251361-156251383 TAGTTGCTTTAGAGGGAAAAGGG - Intronic
1000427037 5:161103409-161103431 AATTTTTTTTTCAGGGAAAAGGG + Intergenic
1000759721 5:165207468-165207490 AATTTGTTTTTGAAGGAAAAAGG - Intergenic
1000893578 5:166828235-166828257 GAGTTGTAAGTGAGGGAAAAAGG + Intergenic
1001580701 5:172796403-172796425 AAGATGCTCTTGAGTTAAAAAGG + Intergenic
1002650864 5:180692349-180692371 ACTTTGTTTTTGAGGGAACAAGG - Intergenic
1003757518 6:9138308-9138330 AAGGTTTTCATGAGGGAGAAAGG - Intergenic
1004938686 6:20533051-20533073 AACTAGATCTTGGGGGAAAAGGG + Intergenic
1005550862 6:26913477-26913499 GAGTTGTTCTGAGGGGAAAATGG + Intergenic
1007667820 6:43526110-43526132 AAGCTGTACATGAGGGAAATGGG + Intronic
1009853390 6:69227464-69227486 AAGTTAAACTTGAGGGTAAATGG + Intronic
1012031770 6:94078288-94078310 AACATGTTCTGGAGAGAAAAAGG - Intergenic
1012979363 6:105813572-105813594 AAGGTGTTCTTGAGGTCCAAAGG - Intergenic
1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG + Intronic
1013452445 6:110297882-110297904 AAGTTGTTCTTGAAGAAGCATGG + Intronic
1014343128 6:120233378-120233400 AGCTTGTTTTTGTGGGAAAAGGG + Intergenic
1014465169 6:121748140-121748162 AAGTTTTAGTTGAGTGAAAAGGG + Intergenic
1014770726 6:125455229-125455251 AAATTGTTTTTGTGTGAAAATGG - Intergenic
1015011907 6:128359375-128359397 ACTTTATTCTTTAGGGAAAATGG - Intronic
1015539527 6:134300097-134300119 AAGGTTTTCCTGAGGGAAGAAGG - Intronic
1015839638 6:137463132-137463154 GAGTTGTTCTTTAAGGACAATGG + Intergenic
1017386975 6:153897627-153897649 ACATTGTTTTTGAGGGAATAGGG - Intergenic
1018538102 6:164845468-164845490 AAGTTTTTCTTCAGGAAAAGGGG - Intergenic
1019486559 7:1292187-1292209 AAGCTGTTCTCAAGCGAAAAGGG - Intergenic
1020852292 7:13369882-13369904 CAGTAGTTATTGAAGGAAAAAGG + Intergenic
1021943591 7:25703886-25703908 GACCTGTTCTTGAGGGAAATTGG - Intergenic
1023463293 7:40424704-40424726 AAATTGTTTTGGAGGCAAAATGG + Intronic
1023582656 7:41699554-41699576 AAGTTTTTATTGAGGGTAGAGGG - Intronic
1023735516 7:43232614-43232636 ATGATGTTCTTGCGGGAAAAGGG + Intronic
1023798746 7:43814855-43814877 TATTTGTTTTTAAGGGAAAAAGG - Intergenic
1026761631 7:73131220-73131242 AAGGTGTTCTTGAGAGCAAGAGG + Intergenic
1027037971 7:74940041-74940063 AAGGTGTTCTTGAGAGCAAGAGG + Intergenic
1027085590 7:75261433-75261455 AAGGTGTTCTTGAGAGCAAGAGG - Intergenic
1027611887 7:80371437-80371459 AAGTTTGTCGTGAGGGACAAGGG + Intronic
1028028274 7:85874949-85874971 ATGGTTTTCTTGGGGGAAAATGG + Intergenic
1030211899 7:107005206-107005228 ACATTGTTTTTGAGGGAATATGG - Intergenic
1032925187 7:136596161-136596183 AAGTTGTTCTAGTGAGGAAAAGG + Intergenic
1033050201 7:137997148-137997170 CAAGTGTTCTTGGGGGAAAAAGG - Intronic
1034830845 7:154306075-154306097 AGTTTGCTCTTGAGGGAAACAGG - Intronic
1036812696 8:11878577-11878599 AGGCTGTTCTTGGGGGAACAGGG - Intergenic
1038113491 8:24526251-24526273 CAGTTGTCCTTAAGGGAAAAAGG - Intronic
1038890048 8:31711322-31711344 AAGTTGTCCTTTAGGAATAAAGG - Intronic
1039031835 8:33317701-33317723 AAGTTTTGCTGGGGGGAAAAAGG - Intergenic
1039623709 8:39025757-39025779 AAAATGTTCTTGGGGAAAAAAGG - Intronic
1039656161 8:39410423-39410445 AAGTTTTTCTGCAGGGAAAAAGG - Intergenic
1040554826 8:48469352-48469374 AAGGTTTTCTTGAGGGATCATGG - Intergenic
1041656680 8:60358817-60358839 AAATTGTTCTTCAGGGAAAATGG - Intergenic
1042085747 8:65106772-65106794 AGGTGATTGTTGAGGGAAAAAGG + Intergenic
1042528028 8:69785212-69785234 AAGTGGTTTTGGAGGCAAAAAGG + Intronic
1043359803 8:79459013-79459035 GAGTTTTTGTTGAGGGAGAATGG - Intergenic
1043583955 8:81746006-81746028 AAGTTGTTTATTAGGGAACAAGG + Intronic
1043826807 8:84938924-84938946 AAGTTGTTCATGGAGGAGAAGGG - Intergenic
1044231749 8:89786726-89786748 AATTTGATCTTGAAAGAAAATGG - Intronic
1044301006 8:90582806-90582828 CAGCTGTTGATGAGGGAAAAAGG - Intergenic
1045723837 8:105147064-105147086 AAGTTGTGCTTGAAAAAAAAGGG + Intronic
1046137856 8:110053745-110053767 AAGATGTTATTTAGTGAAAATGG + Intergenic
1046619758 8:116516433-116516455 AATTTATCCTTGAGGGATAACGG - Intergenic
1047335152 8:123928923-123928945 AAGGTGTTTTTAAGGGAAATGGG + Intronic
1047986454 8:130239788-130239810 AGGTTTTTCATCAGGGAAAAAGG - Intronic
1048638376 8:136325132-136325154 AAGATGTTCCTGAGGGAATGAGG + Intergenic
1049702858 8:144022998-144023020 AAGAGGGTCTTGAGGGAAGAGGG - Intronic
1050058702 9:1682020-1682042 TAGATGTGGTTGAGGGAAAAAGG + Intergenic
1051135407 9:13914606-13914628 ATGTGGTTCTTGAGGGACCAAGG - Intergenic
1051351442 9:16201508-16201530 ATGTTGTTCCTGATGAAAAAAGG - Intergenic
1052127821 9:24799812-24799834 GAGTTGTACTTGATGGAAACAGG - Intergenic
1052153423 9:25150140-25150162 AAGTTGTTCTTCAGTGAGAAGGG - Intergenic
1053532834 9:38898894-38898916 TAGCAGTTCTTGAGGGAAACTGG - Intergenic
1054205060 9:62123323-62123345 TAGCAGTTCTTGAGGGAAACTGG - Intergenic
1054633299 9:67465047-67465069 TAGCAGTTCTTGAGGGAAACTGG + Intergenic
1055130069 9:72765165-72765187 AAGTTGCCCTAGAGGTAAAATGG - Intronic
1056414909 9:86366658-86366680 TATTTGTTTTTAAGGGAAAAAGG + Intergenic
1057079829 9:92164947-92164969 AAGTTGTTCCTGAAGATAAAAGG + Intergenic
1057151381 9:92799006-92799028 TAGCAGTTCTTGAGGGAAACTGG + Intergenic
1058499287 9:105593971-105593993 AAGTTGTTCTTTGGGAAAAGAGG + Intronic
1058671602 9:107364987-107365009 GAGTTGTTGCTGATGGAAAAAGG + Intergenic
1060701662 9:125756961-125756983 AAGTTATTTTTGATTGAAAAGGG + Intronic
1062720048 9:138036112-138036134 AAGCTGTTCTTCAGGCAGAAGGG - Intronic
1186659053 X:11649490-11649512 AAGTTGTAATTGTGGAAAAAGGG - Intronic
1187180304 X:16937860-16937882 ATGTTGTTCATGTGGGAATAGGG - Intergenic
1187310735 X:18138913-18138935 AAGAAGTTCTTCAGAGAAAAGGG + Intergenic
1187787198 X:22905142-22905164 AAGTTGGCTTTGAGGAAAAAAGG + Intergenic
1188020869 X:25156013-25156035 AAGTTCTTCTTGATGCAGAAAGG + Intergenic
1188209960 X:27410819-27410841 AACTTGATCTGGAGGGGAAAGGG - Intergenic
1188678712 X:32975487-32975509 ATTTTGTTGTTGAGAGAAAAAGG - Intronic
1189794773 X:44635236-44635258 AGGTGGTCCTGGAGGGAAAAAGG - Intergenic
1189834371 X:45005404-45005426 TATTTGTTTTTAAGGGAAAAAGG + Intronic
1190650562 X:52564549-52564571 AAGTATTTCTTGAAGGAAAGTGG + Intergenic
1194869684 X:99113815-99113837 AAGTTGTGTTTGAGGGAGATGGG - Intergenic
1195290584 X:103429023-103429045 AACTGGTTCTTGAGGGTAGAGGG - Intergenic
1195544971 X:106103986-106104008 AAGTGTTTATTGAGGGCAAAGGG + Intergenic
1195937599 X:110140416-110140438 AAGTTTTTCTTAAAGAAAAAAGG + Intronic
1198321263 X:135521089-135521111 GAGTTATTCTTGAAGGTAAAGGG + Exonic
1198797762 X:140417079-140417101 AGATTGTTTTTGAGGGTAAAAGG - Intergenic
1198834714 X:140792362-140792384 AAGTAGTAATTAAGGGAAAAGGG - Intergenic
1199305698 X:146265161-146265183 TAGTGGTTCTTGATGGAAATGGG + Intergenic
1199637397 X:149826532-149826554 TATTTGTTTTTAAGGGAAAAAGG - Intergenic
1199782984 X:151080546-151080568 AAATTGTTTTTCAGTGAAAATGG - Intergenic
1200763614 Y:7062246-7062268 TACTTGTTATTAAGGGAAAAAGG + Intronic
1201793134 Y:17864327-17864349 AAGTAATTCTGGAGGTAAAATGG + Intergenic
1201808420 Y:18041659-18041681 AAGTAATTCTGGAGGTAAAATGG - Intergenic
1202339142 Y:23842296-23842318 AAGTAATTCTTGAGGCAAAATGG + Intergenic
1202354667 Y:24033571-24033593 AAGTAATTCTGGAGGTAAAATGG + Intergenic
1202516111 Y:25636541-25636563 AAGTAATTCTGGAGGTAAAATGG - Intergenic
1202531624 Y:25827776-25827798 AAGTAATTCTTGAGGCAAAATGG - Intergenic