ID: 988618953

View in Genome Browser
Species Human (GRCh38)
Location 5:32802869-32802891
Sequence CTGTAAATGTGCAGAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988618950_988618953 -1 Left 988618950 5:32802847-32802869 CCTTCTCTGCCAGCCACGTGTGC 0: 4
1: 17
2: 51
3: 62
4: 238
Right 988618953 5:32802869-32802891 CTGTAAATGTGCAGAGAAGATGG No data
988618949_988618953 0 Left 988618949 5:32802846-32802868 CCCTTCTCTGCCAGCCACGTGTG 0: 4
1: 26
2: 54
3: 60
4: 242
Right 988618953 5:32802869-32802891 CTGTAAATGTGCAGAGAAGATGG No data
988618951_988618953 -10 Left 988618951 5:32802856-32802878 CCAGCCACGTGTGCTGTAAATGT No data
Right 988618953 5:32802869-32802891 CTGTAAATGTGCAGAGAAGATGG No data
988618948_988618953 7 Left 988618948 5:32802839-32802861 CCATCTTCCCTTCTCTGCCAGCC 0: 44
1: 55
2: 48
3: 134
4: 1027
Right 988618953 5:32802869-32802891 CTGTAAATGTGCAGAGAAGATGG No data
988618947_988618953 26 Left 988618947 5:32802820-32802842 CCTATTCAGGATGGCGGCTCCAT No data
Right 988618953 5:32802869-32802891 CTGTAAATGTGCAGAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988618953 Original CRISPR CTGTAAATGTGCAGAGAAGA TGG Intergenic
No off target data available for this crispr