ID: 988620097

View in Genome Browser
Species Human (GRCh38)
Location 5:32814560-32814582
Sequence CATCATACCATTCCCAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988620094_988620097 -6 Left 988620094 5:32814543-32814565 CCTTGTGCTTCTGTCAACATCAT No data
Right 988620097 5:32814560-32814582 CATCATACCATTCCCAAGGAGGG No data
988620093_988620097 16 Left 988620093 5:32814521-32814543 CCTGCAGTATTTAGCTTAGCAAC No data
Right 988620097 5:32814560-32814582 CATCATACCATTCCCAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988620097 Original CRISPR CATCATACCATTCCCAAGGA GGG Intergenic
No off target data available for this crispr