ID: 988623418

View in Genome Browser
Species Human (GRCh38)
Location 5:32846531-32846553
Sequence CTGAATTTACCTGGGTTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988623418_988623425 26 Left 988623418 5:32846531-32846553 CCCTTAAACCCAGGTAAATTCAG No data
Right 988623425 5:32846580-32846602 ACTCTCTGCAGTGTTGGCTGAGG No data
988623418_988623424 20 Left 988623418 5:32846531-32846553 CCCTTAAACCCAGGTAAATTCAG No data
Right 988623424 5:32846574-32846596 TTCAGAACTCTCTGCAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988623418 Original CRISPR CTGAATTTACCTGGGTTTAA GGG (reversed) Intergenic
No off target data available for this crispr