ID: 988624512

View in Genome Browser
Species Human (GRCh38)
Location 5:32858730-32858752
Sequence GAGGACTACTAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988624512_988624517 24 Left 988624512 5:32858730-32858752 CCTTCCTCCTTCTAGTAGTCCTC No data
Right 988624517 5:32858777-32858799 GTCCATAAGTACCCATCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988624512 Original CRISPR GAGGACTACTAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr