ID: 988635036

View in Genome Browser
Species Human (GRCh38)
Location 5:32974012-32974034
Sequence CAGTAACAGGAGCAGTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988635036_988635040 17 Left 988635036 5:32974012-32974034 CCAAACCACTGCTCCTGTTACTG No data
Right 988635040 5:32974052-32974074 TTTCCACAATGTCCTACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988635036 Original CRISPR CAGTAACAGGAGCAGTGGTT TGG (reversed) Intergenic
No off target data available for this crispr