ID: 988635040

View in Genome Browser
Species Human (GRCh38)
Location 5:32974052-32974074
Sequence TTTCCACAATGTCCTACAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988635034_988635040 21 Left 988635034 5:32974008-32974030 CCCTCCAAACCACTGCTCCTGTT No data
Right 988635040 5:32974052-32974074 TTTCCACAATGTCCTACAGTTGG No data
988635033_988635040 22 Left 988635033 5:32974007-32974029 CCCCTCCAAACCACTGCTCCTGT No data
Right 988635040 5:32974052-32974074 TTTCCACAATGTCCTACAGTTGG No data
988635037_988635040 12 Left 988635037 5:32974017-32974039 CCACTGCTCCTGTTACTGTCTCT No data
Right 988635040 5:32974052-32974074 TTTCCACAATGTCCTACAGTTGG No data
988635035_988635040 20 Left 988635035 5:32974009-32974031 CCTCCAAACCACTGCTCCTGTTA No data
Right 988635040 5:32974052-32974074 TTTCCACAATGTCCTACAGTTGG No data
988635038_988635040 4 Left 988635038 5:32974025-32974047 CCTGTTACTGTCTCTACAATTTT No data
Right 988635040 5:32974052-32974074 TTTCCACAATGTCCTACAGTTGG No data
988635036_988635040 17 Left 988635036 5:32974012-32974034 CCAAACCACTGCTCCTGTTACTG No data
Right 988635040 5:32974052-32974074 TTTCCACAATGTCCTACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988635040 Original CRISPR TTTCCACAATGTCCTACAGT TGG Intergenic
No off target data available for this crispr