ID: 988635404

View in Genome Browser
Species Human (GRCh38)
Location 5:32978199-32978221
Sequence CGTTATATGAACAAATTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988635404_988635409 21 Left 988635404 5:32978199-32978221 CCCTTCAATTTGTTCATATAACG No data
Right 988635409 5:32978243-32978265 CAAGAACTTGAGTACCATGAGGG No data
988635404_988635406 -3 Left 988635404 5:32978199-32978221 CCCTTCAATTTGTTCATATAACG No data
Right 988635406 5:32978219-32978241 ACGTAATTCTTCCTACACACTGG No data
988635404_988635410 22 Left 988635404 5:32978199-32978221 CCCTTCAATTTGTTCATATAACG No data
Right 988635410 5:32978244-32978266 AAGAACTTGAGTACCATGAGGGG No data
988635404_988635408 20 Left 988635404 5:32978199-32978221 CCCTTCAATTTGTTCATATAACG No data
Right 988635408 5:32978242-32978264 ACAAGAACTTGAGTACCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988635404 Original CRISPR CGTTATATGAACAAATTGAA GGG (reversed) Intergenic
No off target data available for this crispr