ID: 988636979

View in Genome Browser
Species Human (GRCh38)
Location 5:32995319-32995341
Sequence CTTTGGGAACAGAAAGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988636979_988636981 -9 Left 988636979 5:32995319-32995341 CCATCTACTTTCTGTTCCCAAAG No data
Right 988636981 5:32995333-32995355 TTCCCAAAGCCTAGAGTAGTGGG No data
988636979_988636984 -6 Left 988636979 5:32995319-32995341 CCATCTACTTTCTGTTCCCAAAG No data
Right 988636984 5:32995336-32995358 CCAAAGCCTAGAGTAGTGGGAGG No data
988636979_988636980 -10 Left 988636979 5:32995319-32995341 CCATCTACTTTCTGTTCCCAAAG No data
Right 988636980 5:32995332-32995354 GTTCCCAAAGCCTAGAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988636979 Original CRISPR CTTTGGGAACAGAAAGTAGA TGG (reversed) Intergenic
No off target data available for this crispr