ID: 988637074

View in Genome Browser
Species Human (GRCh38)
Location 5:32996090-32996112
Sequence TGCCAAGATGAGGTATCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988637071_988637074 10 Left 988637071 5:32996057-32996079 CCTATAGAGTTTGCTTCTAGGTC No data
Right 988637074 5:32996090-32996112 TGCCAAGATGAGGTATCATGTGG No data
988637069_988637074 26 Left 988637069 5:32996041-32996063 CCTAGTAAACAGCAAACCTATAG No data
Right 988637074 5:32996090-32996112 TGCCAAGATGAGGTATCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988637074 Original CRISPR TGCCAAGATGAGGTATCATG TGG Intergenic
No off target data available for this crispr