ID: 988638700

View in Genome Browser
Species Human (GRCh38)
Location 5:33016985-33017007
Sequence GCGTTGTTATAGAGGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988638697_988638700 -7 Left 988638697 5:33016969-33016991 CCTAACGTAATCACAAGCGTTGT 0: 1
1: 0
2: 4
3: 50
4: 299
Right 988638700 5:33016985-33017007 GCGTTGTTATAGAGGGATGCAGG 0: 1
1: 0
2: 0
3: 6
4: 52
988638696_988638700 12 Left 988638696 5:33016950-33016972 CCTTGGATTATGAGGTGGACCTA 0: 1
1: 0
2: 0
3: 6
4: 138
Right 988638700 5:33016985-33017007 GCGTTGTTATAGAGGGATGCAGG 0: 1
1: 0
2: 0
3: 6
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988638700 Original CRISPR GCGTTGTTATAGAGGGATGC AGG Intergenic
908152605 1:61318710-61318732 GAGTTGCTATAGAAGGATGGAGG + Intronic
924563155 1:245173726-245173748 GAATGGCTATAGAGGGATGCAGG + Intronic
924747083 1:246846283-246846305 TCGTTTTTACATAGGGATGCAGG - Intronic
1063137700 10:3231590-3231612 GATTTGGTATAGAGGGATTCAGG + Intergenic
1063137714 10:3231649-3231671 GGTTTGGTATAGAGGGATTCAGG + Intergenic
1063137721 10:3231679-3231701 GATTTGGTATAGAGGGATTCAGG + Intergenic
1063137728 10:3231709-3231731 GATTTGGTATAGAGGGATTCAGG + Intergenic
1063137736 10:3231739-3231761 GGTTTGGTATAGAGGGATTCAGG + Intergenic
1065925100 10:30428060-30428082 GGGTTGTCTTAGAGGGCTGCTGG + Intergenic
1071156410 10:82694236-82694258 GCGTTTTTACAGAGTGATGATGG + Intronic
1082728203 11:56762690-56762712 GCACTGTTAGAGAGGGAAGCTGG + Intergenic
1083855322 11:65390381-65390403 CCTTCGTTATAGAGGAATGCAGG + Intronic
1091058632 11:132441617-132441639 ACCTTGTTATATTGGGATGCTGG - Intronic
1092330899 12:7586817-7586839 GTTTTGTTATAAAGGGATGTTGG - Intergenic
1095164508 12:38955925-38955947 GGGTTGTTTTTGAGGGAGGCAGG - Intergenic
1104709848 12:130977787-130977809 GCGAGGTTATACAGGCATGCGGG - Intronic
1107568415 13:41630386-41630408 GGGTTGGTATAGAGAGATGGAGG - Intronic
1113347141 13:109489939-109489961 CTGTTTTTATAGAGGGATTCAGG + Intergenic
1119603668 14:75995793-75995815 ACGTTGCCAAAGAGGGATGCAGG + Intronic
1119775084 14:77243216-77243238 GCTTTGTTCTAAAGGGATGAAGG + Intronic
1124051056 15:26197921-26197943 GCATTGTTATAAAGGAATGCCGG + Intergenic
1135791546 16:25401272-25401294 GGATTTTTATAGAGTGATGCTGG - Intergenic
1138456352 16:57123250-57123272 GCTTTGTTATAGAGAGATTTGGG + Intronic
1139753771 16:69126411-69126433 GCATTGTTATTGAGGCATGGGGG - Intronic
1141059880 16:80856631-80856653 GAGTTGTAATAGATGGATGAAGG - Intergenic
1144557417 17:16294466-16294488 GCTTGGTTATAGAGGGCAGCGGG - Intronic
1145289504 17:21532119-21532141 GCCTTGTTTTACAGGGATGTTGG + Exonic
1147534574 17:41311246-41311268 GTGTTGTGAAAGAGGGATGCAGG + Intergenic
1168463475 19:56582451-56582473 GCATTGTTAAAGTGGAATGCTGG + Exonic
935609536 2:105006677-105006699 GGGGTGTATTAGAGGGATGCTGG - Intergenic
936629592 2:114187551-114187573 GCATTGTTATAAAAGGATGTTGG - Intergenic
942063130 2:172246676-172246698 GCATTGCTATAGAGGAATACTGG + Intergenic
1182884333 22:33760488-33760510 GCGTTGTGATGGAGGAAGGCAGG - Intronic
952203887 3:31159676-31159698 GTCTTGTTATAGAGGAATGTTGG - Intergenic
953899542 3:46832090-46832112 GCCTTTTTCCAGAGGGATGCTGG - Intronic
959745383 3:109770306-109770328 GAGTTGTTATAAAGAGATGCTGG - Intergenic
978916433 4:114131296-114131318 GGGTTTTCATAAAGGGATGCTGG - Intergenic
979790468 4:124774140-124774162 GCGTTTTTATAAAGGGATGTTGG + Intergenic
984619224 4:181933101-181933123 GGTTTGTTATATAGGTATGCAGG - Intergenic
988638700 5:33016985-33017007 GCGTTGTTATAGAGGGATGCAGG + Intergenic
989008491 5:36842549-36842571 GAGTTGTTAAAAATGGATGCTGG + Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
1000752756 5:165117165-165117187 GTGTTGCTATAAAGGGATACTGG + Intergenic
1002067411 5:176658889-176658911 GCTCTGTCATTGAGGGATGCTGG + Exonic
1004190295 6:13457647-13457669 GCTTTGTTATAGATGGTTGTTGG - Intronic
1006523023 6:34583024-34583046 GAGTTGGCATACAGGGATGCGGG - Intergenic
1009812061 6:68680921-68680943 GTGTTGTTATAAAGGAATACTGG + Intronic
1022673877 7:32480365-32480387 GAGTAGTGATAGAGGGATGAGGG + Intergenic
1023139041 7:37082852-37082874 GCCTTGTTATAAAGGGCTCCTGG - Intronic
1023576259 7:41630779-41630801 GTGTTGTTTAAGAGGGTTGCAGG + Intergenic
1029372055 7:100156554-100156576 GAGTGGTGAGAGAGGGATGCTGG + Intronic
1032654695 7:133915205-133915227 GCTTTGTTAGAGAGGAATGCAGG + Intronic
1035977103 8:4324715-4324737 GTGTTGTTATATATGGATGAAGG + Intronic
1037101526 8:15053027-15053049 GAGTTATTACAGAGGAATGCTGG - Intronic
1043229316 8:77780853-77780875 GTGTTGCTAAAGAGGTATGCAGG - Intergenic
1049044613 8:140139491-140139513 GCGCTGTTATATAAGGATGCTGG - Intronic
1057880527 9:98789858-98789880 GCCTTGTTATAGAGGCTTCCAGG + Intronic
1193321493 X:80127435-80127457 TCTTTATTATAAAGGGATGCTGG + Intergenic
1198008826 X:132529190-132529212 GTTTTGTCATAAAGGGATGCTGG + Intergenic