ID: 988655693

View in Genome Browser
Species Human (GRCh38)
Location 5:33209421-33209443
Sequence TCAGCAAACCTTCTGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988655693_988655706 23 Left 988655693 5:33209421-33209443 CCTGCCACCAGAAGGTTTGCTGA No data
Right 988655706 5:33209467-33209489 GCTCCTTGAGGTTATCTACTGGG No data
988655693_988655700 1 Left 988655693 5:33209421-33209443 CCTGCCACCAGAAGGTTTGCTGA No data
Right 988655700 5:33209445-33209467 GGCAGTCAGCCCCTGGCGCTGGG No data
988655693_988655703 11 Left 988655693 5:33209421-33209443 CCTGCCACCAGAAGGTTTGCTGA No data
Right 988655703 5:33209455-33209477 CCCTGGCGCTGGGCTCCTTGAGG No data
988655693_988655705 22 Left 988655693 5:33209421-33209443 CCTGCCACCAGAAGGTTTGCTGA No data
Right 988655705 5:33209466-33209488 GGCTCCTTGAGGTTATCTACTGG No data
988655693_988655699 0 Left 988655693 5:33209421-33209443 CCTGCCACCAGAAGGTTTGCTGA No data
Right 988655699 5:33209444-33209466 GGGCAGTCAGCCCCTGGCGCTGG No data
988655693_988655698 -6 Left 988655693 5:33209421-33209443 CCTGCCACCAGAAGGTTTGCTGA No data
Right 988655698 5:33209438-33209460 TGCTGAGGGCAGTCAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988655693 Original CRISPR TCAGCAAACCTTCTGGTGGC AGG (reversed) Intergenic