ID: 988655696

View in Genome Browser
Species Human (GRCh38)
Location 5:33209425-33209447
Sequence GCCCTCAGCAAACCTTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988655696_988655706 19 Left 988655696 5:33209425-33209447 CCACCAGAAGGTTTGCTGAGGGC No data
Right 988655706 5:33209467-33209489 GCTCCTTGAGGTTATCTACTGGG No data
988655696_988655698 -10 Left 988655696 5:33209425-33209447 CCACCAGAAGGTTTGCTGAGGGC No data
Right 988655698 5:33209438-33209460 TGCTGAGGGCAGTCAGCCCCTGG No data
988655696_988655703 7 Left 988655696 5:33209425-33209447 CCACCAGAAGGTTTGCTGAGGGC No data
Right 988655703 5:33209455-33209477 CCCTGGCGCTGGGCTCCTTGAGG No data
988655696_988655699 -4 Left 988655696 5:33209425-33209447 CCACCAGAAGGTTTGCTGAGGGC No data
Right 988655699 5:33209444-33209466 GGGCAGTCAGCCCCTGGCGCTGG No data
988655696_988655705 18 Left 988655696 5:33209425-33209447 CCACCAGAAGGTTTGCTGAGGGC No data
Right 988655705 5:33209466-33209488 GGCTCCTTGAGGTTATCTACTGG No data
988655696_988655700 -3 Left 988655696 5:33209425-33209447 CCACCAGAAGGTTTGCTGAGGGC No data
Right 988655700 5:33209445-33209467 GGCAGTCAGCCCCTGGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988655696 Original CRISPR GCCCTCAGCAAACCTTCTGG TGG (reversed) Intergenic