ID: 988655698

View in Genome Browser
Species Human (GRCh38)
Location 5:33209438-33209460
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988655696_988655698 -10 Left 988655696 5:33209425-33209447 CCACCAGAAGGTTTGCTGAGGGC No data
Right 988655698 5:33209438-33209460 TGCTGAGGGCAGTCAGCCCCTGG No data
988655693_988655698 -6 Left 988655693 5:33209421-33209443 CCTGCCACCAGAAGGTTTGCTGA No data
Right 988655698 5:33209438-33209460 TGCTGAGGGCAGTCAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type