ID: 988655703

View in Genome Browser
Species Human (GRCh38)
Location 5:33209455-33209477
Sequence CCCTGGCGCTGGGCTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988655697_988655703 4 Left 988655697 5:33209428-33209450 CCAGAAGGTTTGCTGAGGGCAGT No data
Right 988655703 5:33209455-33209477 CCCTGGCGCTGGGCTCCTTGAGG No data
988655696_988655703 7 Left 988655696 5:33209425-33209447 CCACCAGAAGGTTTGCTGAGGGC No data
Right 988655703 5:33209455-33209477 CCCTGGCGCTGGGCTCCTTGAGG No data
988655693_988655703 11 Left 988655693 5:33209421-33209443 CCTGCCACCAGAAGGTTTGCTGA No data
Right 988655703 5:33209455-33209477 CCCTGGCGCTGGGCTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988655703 Original CRISPR CCCTGGCGCTGGGCTCCTTG AGG Intergenic