ID: 988655706

View in Genome Browser
Species Human (GRCh38)
Location 5:33209467-33209489
Sequence GCTCCTTGAGGTTATCTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988655697_988655706 16 Left 988655697 5:33209428-33209450 CCAGAAGGTTTGCTGAGGGCAGT No data
Right 988655706 5:33209467-33209489 GCTCCTTGAGGTTATCTACTGGG No data
988655701_988655706 -10 Left 988655701 5:33209454-33209476 CCCCTGGCGCTGGGCTCCTTGAG No data
Right 988655706 5:33209467-33209489 GCTCCTTGAGGTTATCTACTGGG No data
988655696_988655706 19 Left 988655696 5:33209425-33209447 CCACCAGAAGGTTTGCTGAGGGC No data
Right 988655706 5:33209467-33209489 GCTCCTTGAGGTTATCTACTGGG No data
988655693_988655706 23 Left 988655693 5:33209421-33209443 CCTGCCACCAGAAGGTTTGCTGA No data
Right 988655706 5:33209467-33209489 GCTCCTTGAGGTTATCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988655706 Original CRISPR GCTCCTTGAGGTTATCTACT GGG Intergenic